Mutagenetix > Incidental Mutations

Incidental Mutation 'R8145:Taf4b'

632787

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R8145 (G1)

Quality Score

175.009

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 14830028 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 608 (D608E)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000169862
AA Change: D608E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: D608E

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Coding Region Coverage

1x: 99.7%
3x: 99.5%
10x: 97.9%
20x: 90.4%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,998,267	S3039P	probably damaging	Het
5430419D17Rik	G	T	7: 131,296,316	V2088L	unknown	Het
Alg6	A	T	4: 99,746,327	D273V	probably damaging	Het
Ankk1	T	A	9: 49,415,797	H694L	possibly damaging	Het
Asb7	G	T	7: 66,659,948	N173K	probably benign	Het
Atp10b	A	T	11: 43,202,122	Q428L	probably damaging	Het
Bag3	A	G	7: 128,545,888	E409G	possibly damaging	Het
Bpifb2	T	A	2: 153,891,312	V398E	probably damaging	Het
Ccr6	T	C	17: 8,256,113	V50A	probably benign	Het
Cdx1	T	C	18: 61,019,923	N204D	probably damaging	Het
Ciao1	T	C	2: 127,245,806	D203G	possibly damaging	Het
Cldn7	A	T	11: 69,966,066	Y47F	possibly damaging	Het
Col6a1	A	T	10: 76,723,471	D110E	possibly damaging	Het
Cpne6	C	A	14: 55,514,568	Q261K	probably benign	Het
Crebbp	T	C	16: 4,128,525	T497A	probably benign	Het
Cyp2s1	A	G	7: 25,808,042		probably null	Het
Ddx42	A	T	11: 106,240,061	I454F	possibly damaging	Het
Ddx5	G	T	11: 106,782,085	A538E	probably benign	Het
Dnajb1	T	A	8: 83,610,315	V238D	probably damaging	Het
Dntt	A	G	19: 41,055,785	Y463C	probably damaging	Het
Eif4b	A	G	15: 102,092,988	T437A	unknown	Het
Eppk1	T	C	15: 76,106,700	T1994A	possibly damaging	Het
Fbxw15	A	T	9: 109,555,590	C381S	probably benign	Het
Fosl2	T	A	5: 32,153,068	V287D	probably damaging	Het
Gdpd4	A	G	7: 98,040,870	T590A	probably benign	Het
Gm20075	A	T	13: 96,081,141	D63E	probably benign	Het
Gm21994	T	C	2: 150,254,535	K325E	probably benign	Het
Gm49368	A	G	7: 128,113,315	E877G	probably null	Het
Grin2b	C	T	6: 135,732,499	A1350T	probably benign	Het
Gzmk	A	G	13: 113,171,896	L257P	probably damaging	Het
Has2	T	A	15: 56,681,779	K142N	probably benign	Het
Hectd1	T	C	12: 51,784,233	E944G	possibly damaging	Het
Hmcn1	T	C	1: 150,753,660	R949G	probably benign	Het
Hmcn2	A	G	2: 31,423,105	E3442G	probably damaging	Het
Irf9	T	A	14: 55,605,798	C152*	probably null	Het
Itga3	A	G	11: 95,052,464	W936R	probably damaging	Het
Klhl11	G	T	11: 100,463,914	D360E	probably damaging	Het
Lnx1	G	A	5: 74,685,399	T130I	probably benign	Het
Lrrc36	C	T	8: 105,443,764	P82L	probably damaging	Het
Map4k4	T	C	1: 40,000,534	C29R		Het
Mki67	T	C	7: 135,694,336	K2990E	probably benign	Het
Mnt	G	A	11: 74,842,973	A477T	unknown	Het
Mroh9	A	G	1: 163,062,527	S214P	probably benign	Het
Mrps18b	C	A	17: 35,914,401	R94L	possibly damaging	Het
Myh6	T	A	14: 54,953,925	I820F	probably benign	Het
Nphp3	A	G	9: 104,035,851	T943A	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,623	H229R	probably benign	Het
Olfr559	C	A	7: 102,723,730	L253F	probably damaging	Het
Papolb	T	C	5: 142,528,598	D430G	probably benign	Het
Pdzd2	T	C	15: 12,407,372	H334R	probably benign	Het
Pkd1l2	T	A	8: 117,055,003	M768L	probably benign	Het
Pklr	G	T	3: 89,145,488	R547L	probably benign	Het
Pla2g4a	T	C	1: 149,840,643	Y697C	probably benign	Het
Prkcd	T	C	14: 30,602,062	T435A	probably benign	Het
Rfx1	C	T	8: 84,074,028	P86L	probably benign	Het
Rnf19b	C	A	4: 129,084,069	A693D	probably benign	Het
Scn9a	A	G	2: 66,487,410	I1578T	probably damaging	Het
Slamf9	A	G	1: 172,476,375	S96G	probably benign	Het
Slc17a8	T	C	10: 89,576,371	D584G	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc2a7	C	A	4: 150,168,361	T486K	probably damaging	Het
Slc6a20a	G	A	9: 123,637,000	A592V	probably damaging	Het
Spz1	T	C	13: 92,575,101	D289G	probably benign	Het
Sspo	G	A	6: 48,467,749	C2226Y	possibly damaging	Het
Tagap1	A	T	17: 6,956,127	I390N	probably damaging	Het
Tcp11l2	A	G	10: 84,608,616	N430D	probably damaging	Het
Thsd7b	T	C	1: 129,760,299	L649P	probably damaging	Het
Tmprss15	C	T	16: 78,960,585	G956R	probably damaging	Het
Tnc	G	T	4: 64,017,479	Q407K	probably benign	Het
Tti1	C	A	2: 158,007,589	E577*	probably null	Het
Vmn2r79	A	T	7: 87,037,654	M748L	probably benign	Het
Zbtb37	C	T	1: 161,020,084	R451Q	probably damaging	Het
Zfp566	A	T	7: 30,078,360	I132N	probably benign	Het
Zik1	C	T	7: 10,490,003	G389E	probably damaging	Het
Zzef1	A	T	11: 72,908,469	K2382*	probably null	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGGCGTTCTTAAAGTCACTTCG -3'
(R):5'- AACATTCCTACTGGGTCAAGAATC -3'

Sequencing Primer
(F):5'- CGTTCTTAAAGTCACTTCGTAGGG -3'
(R):5'- CCTACTGGGTCAAGAATCATGATC -3'

Posted On

2020-06-30