Incidental Mutation 'R8145:Dntt'
ID632789
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Namedeoxynucleotidyltransferase, terminal
SynonymsTdt
MMRRC Submission
Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8145 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41029275-41059523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41055785 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 463 (Y463C)
Ref Sequence ENSEMBL: ENSMUSP00000107819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]
Predicted Effect probably damaging
Transcript: ENSMUST00000051806
AA Change: Y463C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014
AA Change: Y463C

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112200
AA Change: Y463C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014
AA Change: Y463C

DomainStartEndE-ValueType
BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Meta Mutation Damage Score 0.4026 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 90.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,998,267 S3039P probably damaging Het
5430419D17Rik G T 7: 131,296,316 V2088L unknown Het
Alg6 A T 4: 99,746,327 D273V probably damaging Het
Ankk1 T A 9: 49,415,797 H694L possibly damaging Het
Asb7 G T 7: 66,659,948 N173K probably benign Het
Atp10b A T 11: 43,202,122 Q428L probably damaging Het
Bag3 A G 7: 128,545,888 E409G possibly damaging Het
Bpifb2 T A 2: 153,891,312 V398E probably damaging Het
Ccr6 T C 17: 8,256,113 V50A probably benign Het
Cdx1 T C 18: 61,019,923 N204D probably damaging Het
Ciao1 T C 2: 127,245,806 D203G possibly damaging Het
Cldn7 A T 11: 69,966,066 Y47F possibly damaging Het
Col6a1 A T 10: 76,723,471 D110E possibly damaging Het
Cpne6 C A 14: 55,514,568 Q261K probably benign Het
Crebbp T C 16: 4,128,525 T497A probably benign Het
Cyp2s1 A G 7: 25,808,042 probably null Het
Ddx42 A T 11: 106,240,061 I454F possibly damaging Het
Ddx5 G T 11: 106,782,085 A538E probably benign Het
Dnajb1 T A 8: 83,610,315 V238D probably damaging Het
Eif4b A G 15: 102,092,988 T437A unknown Het
Eppk1 T C 15: 76,106,700 T1994A possibly damaging Het
Fbxw15 A T 9: 109,555,590 C381S probably benign Het
Fosl2 T A 5: 32,153,068 V287D probably damaging Het
Gdpd4 A G 7: 98,040,870 T590A probably benign Het
Gm20075 A T 13: 96,081,141 D63E probably benign Het
Gm21994 T C 2: 150,254,535 K325E probably benign Het
Gm49368 A G 7: 128,113,315 E877G probably null Het
Grin2b C T 6: 135,732,499 A1350T probably benign Het
Gzmk A G 13: 113,171,896 L257P probably damaging Het
Has2 T A 15: 56,681,779 K142N probably benign Het
Hectd1 T C 12: 51,784,233 E944G possibly damaging Het
Hmcn1 T C 1: 150,753,660 R949G probably benign Het
Hmcn2 A G 2: 31,423,105 E3442G probably damaging Het
Irf9 T A 14: 55,605,798 C152* probably null Het
Itga3 A G 11: 95,052,464 W936R probably damaging Het
Klhl11 G T 11: 100,463,914 D360E probably damaging Het
Lnx1 G A 5: 74,685,399 T130I probably benign Het
Lrrc36 C T 8: 105,443,764 P82L probably damaging Het
Map4k4 T C 1: 40,000,534 C29R Het
Mki67 T C 7: 135,694,336 K2990E probably benign Het
Mnt G A 11: 74,842,973 A477T unknown Het
Mroh9 A G 1: 163,062,527 S214P probably benign Het
Mrps18b C A 17: 35,914,401 R94L possibly damaging Het
Myh6 T A 14: 54,953,925 I820F probably benign Het
Nphp3 A G 9: 104,035,851 T943A probably benign Het
Olfr548-ps1 A G 7: 102,542,623 H229R probably benign Het
Olfr559 C A 7: 102,723,730 L253F probably damaging Het
Papolb T C 5: 142,528,598 D430G probably benign Het
Pdzd2 T C 15: 12,407,372 H334R probably benign Het
Pkd1l2 T A 8: 117,055,003 M768L probably benign Het
Pklr G T 3: 89,145,488 R547L probably benign Het
Pla2g4a T C 1: 149,840,643 Y697C probably benign Het
Prkcd T C 14: 30,602,062 T435A probably benign Het
Rfx1 C T 8: 84,074,028 P86L probably benign Het
Rnf19b C A 4: 129,084,069 A693D probably benign Het
Scn9a A G 2: 66,487,410 I1578T probably damaging Het
Slamf9 A G 1: 172,476,375 S96G probably benign Het
Slc17a8 T C 10: 89,576,371 D584G probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc2a7 C A 4: 150,168,361 T486K probably damaging Het
Slc6a20a G A 9: 123,637,000 A592V probably damaging Het
Spz1 T C 13: 92,575,101 D289G probably benign Het
Sspo G A 6: 48,467,749 C2226Y possibly damaging Het
Taf4b T G 18: 14,830,028 D608E probably damaging Het
Tagap1 A T 17: 6,956,127 I390N probably damaging Het
Tcp11l2 A G 10: 84,608,616 N430D probably damaging Het
Thsd7b T C 1: 129,760,299 L649P probably damaging Het
Tmprss15 C T 16: 78,960,585 G956R probably damaging Het
Tnc G T 4: 64,017,479 Q407K probably benign Het
Tti1 C A 2: 158,007,589 E577* probably null Het
Vmn2r79 A T 7: 87,037,654 M748L probably benign Het
Zbtb37 C T 1: 161,020,084 R451Q probably damaging Het
Zfp566 A T 7: 30,078,360 I132N probably benign Het
Zik1 C T 7: 10,490,003 G389E probably damaging Het
Zzef1 A T 11: 72,908,469 K2382* probably null Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41039823 missense probably benign 0.01
IGL01531:Dntt APN 19 41053238 nonsense probably null
IGL01859:Dntt APN 19 41037304 missense probably benign
IGL02053:Dntt APN 19 41046274 missense probably benign 0.00
IGL02411:Dntt APN 19 41052985 splice site probably null
IGL03180:Dntt APN 19 41029551 missense probably benign 0.09
R0106:Dntt UTSW 19 41055746 splice site probably benign
R0122:Dntt UTSW 19 41053038 missense possibly damaging 0.95
R0194:Dntt UTSW 19 41038970 missense possibly damaging 0.90
R0266:Dntt UTSW 19 41059127 missense probably damaging 0.99
R0377:Dntt UTSW 19 41047627 nonsense probably null
R0412:Dntt UTSW 19 41042933 missense probably damaging 1.00
R0604:Dntt UTSW 19 41053149 missense probably benign 0.01
R1350:Dntt UTSW 19 41037139 splice site probably benign
R1577:Dntt UTSW 19 41055785 missense probably damaging 1.00
R1677:Dntt UTSW 19 41029484 missense probably benign 0.26
R2567:Dntt UTSW 19 41041336 missense possibly damaging 0.81
R4380:Dntt UTSW 19 41053233 missense probably damaging 1.00
R4703:Dntt UTSW 19 41039803 missense probably benign 0.00
R4999:Dntt UTSW 19 41039856 missense probably damaging 0.99
R6257:Dntt UTSW 19 41053062 missense probably damaging 1.00
R6757:Dntt UTSW 19 41037162 missense probably damaging 1.00
R7340:Dntt UTSW 19 41058565 critical splice acceptor site probably null
R7388:Dntt UTSW 19 41038979 missense probably benign 0.01
R7553:Dntt UTSW 19 41029487 missense probably damaging 0.99
R7806:Dntt UTSW 19 41029632 missense probably benign 0.02
YA93:Dntt UTSW 19 41053187 missense probably benign
Z1177:Dntt UTSW 19 41055815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTGCCCTGAGGAAGAAAG -3'
(R):5'- CGGAGTTCCATCCCTAGAAC -3'

Sequencing Primer
(F):5'- TTGCCCTGAGGAAGAAAGTCACC -3'
(R):5'- GGAGTTCCATCCCTAGAACCTATGTG -3'
Posted On2020-06-30