Mutagenetix > Incidental Mutations

Incidental Mutation 'R0102:Dnttip2'

63279

Institutional Source

Beutler Lab

Gene Symbol

Dnttip2

Ensembl Gene

ENSMUSG00000039756

Gene Name

deoxynucleotidyltransferase, terminal, interacting protein 2

Synonyms

4930588M11Rik

MMRRC Submission

038388-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R0102 (G1)

Quality Score

165

Status

Validated

Chromosome

Chromosomal Location

122274388-122285271 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 122275803 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 222 (M222I)

Ref Sequence

ENSEMBL: ENSMUSP00000045043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035776]

Predicted Effect

probably benign
Transcript: ENSMUST00000035776
AA Change: M222I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: M222I

Domain	Start	End	E-Value	Type
low complexity region	125	143	N/A	INTRINSIC
low complexity region	447	458	N/A	INTRINSIC
coiled coil region	513	541	N/A	INTRINSIC
low complexity region	550	565	N/A	INTRINSIC
Pfam:Fcf2	639	733	3.4e-41	PFAM
low complexity region	748	756	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000072769

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196338

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199627

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.5%
20x: 91.8%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,068,113	K1021R	probably damaging	Het
2610528J11Rik	G	A	4: 118,529,565	V36M	probably damaging	Het
4930402F06Rik	T	A	2: 35,375,783	R292*	probably null	Het
Abcb4	T	C	5: 8,909,194	F207S	probably damaging	Het
Afap1l2	G	T	19: 56,928,440		probably benign	Het
Arfgef2	A	T	2: 166,845,465	H203L	probably benign	Het
Cfi	A	C	3: 129,848,767	H90P	probably damaging	Het
Col1a2	T	A	6: 4,520,775	S371T	possibly damaging	Het
Cyp2d10	C	T	15: 82,404,593	M229I	probably benign	Het
Dnah5	A	G	15: 28,245,751		probably benign	Het
Dync1li2	A	T	8: 104,428,125	Y284N	probably benign	Het
Ebf1	T	C	11: 44,991,455	Y413H	probably benign	Het
Exog	A	G	9: 119,452,253	T186A	possibly damaging	Het
Fam171a2	T	C	11: 102,444,113	N66S	possibly damaging	Het
Gad1	G	A	2: 70,587,239		probably null	Het
Golgb1	C	A	16: 36,875,468		probably benign	Het
Gprc5a	A	T	6: 135,079,035	N160I	probably damaging	Het
Haus3	A	G	5: 34,165,914		probably null	Het
Klhl20	A	T	1: 161,090,445	C90*	probably null	Het
Krt84	T	A	15: 101,528,703	I342L	probably damaging	Het
Lifr	G	A	15: 7,178,892	D584N	probably damaging	Het
Lrp1b	G	A	2: 41,408,985		probably benign	Het
Lrtm1	T	A	14: 29,022,227		probably benign	Het
Med25	C	T	7: 44,885,480	V80I	possibly damaging	Het
Mest	A	G	6: 30,746,270	I279V	probably damaging	Het
Mki67	T	C	7: 135,713,803	R81G	probably benign	Het
Naa25	A	G	5: 121,435,569	D787G	possibly damaging	Het
Naaladl1	C	T	19: 6,112,504	P465S	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Necab3	G	A	2: 154,545,312	R302C	probably damaging	Het
Nsg1	A	T	5: 38,158,910	D32E	probably damaging	Het
Nuggc	A	G	14: 65,613,551	D290G	probably null	Het
Nup205	A	T	6: 35,225,780		probably benign	Het
Olfr1100	A	T	2: 86,978,205	I197N	possibly damaging	Het
Olfr1216	T	C	2: 89,013,671	Y131C	probably damaging	Het
Olfr1250	T	C	2: 89,656,655	N262S	probably benign	Het
Olfr1308	G	C	2: 111,960,597	Q159E	probably damaging	Het
Olfr1361	T	C	13: 21,658,735	D196G	probably damaging	Het
Olfr743	T	A	14: 50,533,631	L73Q	probably damaging	Het
Otp	T	C	13: 94,877,155	V27A	probably benign	Het
Phip	A	T	9: 82,905,792		probably null	Het
Pon2	A	G	6: 5,289,091		probably benign	Het
Ppp1r12b	T	A	1: 134,835,899		probably null	Het
Ppp1r15b	A	G	1: 133,133,170	N475S	probably damaging	Het
Prrt3	A	T	6: 113,497,829	L144H	probably damaging	Het
Psmb7	A	G	2: 38,643,365	V50A	possibly damaging	Het
Sacs	T	A	14: 61,204,568	S1354R	probably damaging	Het
Sdcbp2	A	G	2: 151,583,964	T29A	probably benign	Het
Shbg	T	A	11: 69,617,589		probably benign	Het
Shcbp1	A	G	8: 4,744,452	I447T	probably damaging	Het
Tbc1d9b	T	C	11: 50,135,849	V48A	probably damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trappc12	A	T	12: 28,746,752	F260L	probably damaging	Het
Trim10	C	A	17: 36,870,182	H102N	probably damaging	Het
Ube2u	A	G	4: 100,549,925	T215A	possibly damaging	Het
Vcan	T	G	13: 89,703,668	T1058P	probably benign	Het

Other mutations in Dnttip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Dnttip2	APN	3	122284499	missense	probably damaging	1.00
IGL00921:Dnttip2	APN	3	122275290	missense	probably benign	0.03
IGL01120:Dnttip2	APN	3	122278737	splice site	probably benign
IGL01341:Dnttip2	APN	3	122276612	missense	probably damaging	1.00
IGL01636:Dnttip2	APN	3	122282474	missense	possibly damaging	0.95
IGL01988:Dnttip2	APN	3	122276295	missense	probably benign	0.05
IGL02096:Dnttip2	APN	3	122284413	missense	possibly damaging	0.51
IGL02216:Dnttip2	APN	3	122276261	missense	probably benign	0.01
IGL03234:Dnttip2	APN	3	122282438	missense	probably damaging	1.00
Abyss	UTSW	3	122276221	missense	probably damaging	0.99
Chasm	UTSW	3	122275808	missense	probably damaging	1.00
R0089:Dnttip2	UTSW	3	122275462	missense	possibly damaging	0.59
R0102:Dnttip2	UTSW	3	122275803	missense	probably benign	0.00
R0195:Dnttip2	UTSW	3	122276161	missense	probably benign	0.02
R1103:Dnttip2	UTSW	3	122276422	missense	probably benign	0.02
R1733:Dnttip2	UTSW	3	122276748	missense	probably benign	0.25
R1759:Dnttip2	UTSW	3	122276149	missense	probably benign	0.21
R2019:Dnttip2	UTSW	3	122280744	missense	possibly damaging	0.93
R2022:Dnttip2	UTSW	3	122276221	missense	probably damaging	1.00
R2415:Dnttip2	UTSW	3	122276537	missense	probably damaging	1.00
R3913:Dnttip2	UTSW	3	122275391	missense	possibly damaging	0.68
R4194:Dnttip2	UTSW	3	122280761	missense	probably damaging	1.00
R4367:Dnttip2	UTSW	3	122276497	missense	probably damaging	1.00
R4871:Dnttip2	UTSW	3	122285101	missense	probably damaging	1.00
R4888:Dnttip2	UTSW	3	122276592	missense	probably damaging	1.00
R5082:Dnttip2	UTSW	3	122275941	missense	probably damaging	0.98
R5436:Dnttip2	UTSW	3	122278769	missense	probably damaging	1.00
R5483:Dnttip2	UTSW	3	122276797	missense	probably damaging	0.97
R5933:Dnttip2	UTSW	3	122275568	missense	probably benign	0.07
R5966:Dnttip2	UTSW	3	122285168	utr 3 prime	probably benign
R6171:Dnttip2	UTSW	3	122278862	missense	probably damaging	0.99
R6251:Dnttip2	UTSW	3	122275256	missense	probably benign	0.14
R6286:Dnttip2	UTSW	3	122284400	missense	probably damaging	1.00
R6512:Dnttip2	UTSW	3	122275523	missense	possibly damaging	0.67
R6519:Dnttip2	UTSW	3	122275471	missense	probably benign	0.05
R6670:Dnttip2	UTSW	3	122276221	missense	probably damaging	0.99
R6833:Dnttip2	UTSW	3	122276803	missense	probably damaging	0.99
R6870:Dnttip2	UTSW	3	122275808	missense	probably damaging	1.00
R6969:Dnttip2	UTSW	3	122282492	missense	probably damaging	1.00
R7038:Dnttip2	UTSW	3	122276532	nonsense	probably null
R7233:Dnttip2	UTSW	3	122276390	missense	probably benign	0.26
R7423:Dnttip2	UTSW	3	122275526	missense	probably benign
R7591:Dnttip2	UTSW	3	122276468	nonsense	probably null
R7765:Dnttip2	UTSW	3	122275945	missense	probably benign	0.09
R7842:Dnttip2	UTSW	3	122276341	missense	probably benign	0.03
R7899:Dnttip2	UTSW	3	122282369	missense	probably damaging	1.00
R8408:Dnttip2	UTSW	3	122276702	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCGGGAACTGTATCTGATGCTGAG -3'
(R):5'- TGAGACACTGACTGCTGAAGGCTG -3'

Sequencing Primer
(F):5'- AACTGTATCTGATGCTGAGTTGTCC -3'
(R):5'- GTCTTGAGCTTCAGAAAGACTCC -3'

Posted On

2013-07-30