Incidental Mutation 'R8146:Cdh4'
ID 632797
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Name cadherin 4
Synonyms R-Cadh, Rcad, R-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8146 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 179442431-179899373 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 179874078 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 350 (Q350K)
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314]
AlphaFold P39038
Predicted Effect possibly damaging
Transcript: ENSMUST00000000314
AA Change: Q350K

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: Q350K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T G 2: 19,494,003 E393A possibly damaging Het
4930550C14Rik A G 9: 53,422,970 D171G probably damaging Het
Abca13 T C 11: 9,397,829 Y3561H probably damaging Het
Adgra2 T A 8: 27,114,174 V464D probably damaging Het
Adgrl1 C A 8: 83,930,989 T408N possibly damaging Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Anks6 C A 4: 47,043,605 A375S unknown Het
Bbs10 T A 10: 111,300,535 I503K probably benign Het
Birc2 A G 9: 7,818,796 I598T probably damaging Het
Cbl A T 9: 44,164,874 D339E probably damaging Het
Cep78 A G 19: 15,956,363 L617P probably damaging Het
Cnbd2 T G 2: 156,328,361 V122G probably damaging Het
Crem A T 18: 3,288,007 N158K possibly damaging Het
Cul1 T C 6: 47,495,093 V56A possibly damaging Het
Dopey2 T A 16: 93,749,939 I277N possibly damaging Het
Exoc3 T C 13: 74,192,665 D340G probably benign Het
Exoc6b A C 6: 84,908,194 D254E probably benign Het
Fyttd1 A G 16: 32,902,492 K268E probably damaging Het
Gbp8 T A 5: 105,030,978 N157I probably benign Het
Hacd1 T A 2: 14,044,794 S118C probably damaging Het
Hcn4 A C 9: 58,823,744 E78A unknown Het
Inpp5e T A 2: 26,399,262 T549S probably benign Het
Kcnh4 T C 11: 100,755,279 N281S probably damaging Het
Kdm5b A G 1: 134,625,126 D1280G probably benign Het
Lrfn3 A G 7: 30,359,879 V307A probably benign Het
Mafb A G 2: 160,366,378 L100P probably damaging Het
Med24 C T 11: 98,718,114 G119R probably benign Het
Mvp G T 7: 126,986,999 P866Q probably benign Het
Olfr630 A G 7: 103,755,303 I94T probably damaging Het
Phykpl T C 11: 51,585,581 Y43H probably damaging Het
Prag1 T G 8: 36,104,210 L649R probably damaging Het
Ptgdr2 T C 19: 10,940,997 F293L probably damaging Het
Rasip1 T G 7: 45,630,280 S316A possibly damaging Het
Rlf G A 4: 121,147,232 S1627L probably benign Het
Rtl1 T C 12: 109,590,711 R1565G probably benign Het
Sart3 G A 5: 113,747,957 T572M probably damaging Het
Sec24b G T 3: 129,995,924 S816* probably null Het
Slamf1 C T 1: 171,792,319 P279L probably benign Het
Slc18a1 C A 8: 69,042,749 V368F possibly damaging Het
Tap1 A T 17: 34,189,232 D194V probably damaging Het
Tuba1c A G 15: 99,037,615 Y319C probably damaging Het
Unc79 T A 12: 103,070,157 I579N probably damaging Het
Zbtb22 G T 17: 33,916,982 V34L probably damaging Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179874144 missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179780403 missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179890884 missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179780474 missense probably benign 0.01
R0082:Cdh4 UTSW 2 179894188 missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179847340 missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179886864 critical splice donor site probably null
R1622:Cdh4 UTSW 2 179889092 missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179797480 missense probably benign 0.01
R1794:Cdh4 UTSW 2 179886842 missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179890847 missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179797524 missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179780367 missense probably benign 0.09
R3861:Cdh4 UTSW 2 179874097 missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179889173 missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179780389 missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179780467 missense probably benign 0.03
R4893:Cdh4 UTSW 2 179847419 intron probably benign
R5029:Cdh4 UTSW 2 179881949 missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179886763 missense probably benign
R5542:Cdh4 UTSW 2 179860226 missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179885996 missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179895767 missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179797626 missense probably damaging 1.00
R6338:Cdh4 UTSW 2 179890812 missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179881996 critical splice donor site probably null
R6607:Cdh4 UTSW 2 179874096 missense probably benign 0.00
R6653:Cdh4 UTSW 2 179780428 missense probably benign 0.34
R6711:Cdh4 UTSW 2 179890931 missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179847387 missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179860194 missense probably benign 0.19
R6981:Cdh4 UTSW 2 179797504 missense probably benign 0.28
R7285:Cdh4 UTSW 2 179797465 missense probably benign 0.00
R7514:Cdh4 UTSW 2 179890843 missense possibly damaging 0.91
R7541:Cdh4 UTSW 2 179444810 splice site probably null
R7560:Cdh4 UTSW 2 179890902 missense probably benign 0.25
R8833:Cdh4 UTSW 2 179894035 missense possibly damaging 0.61
R9075:Cdh4 UTSW 2 179860147 missense probably damaging 0.97
R9203:Cdh4 UTSW 2 179780403 missense probably damaging 0.96
Z1177:Cdh4 UTSW 2 179780326 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TGAATGCACCCACTGAAAGC -3'
(R):5'- TCTTCTCCCCACTGAGAGAG -3'

Sequencing Primer
(F):5'- TGCACCCACTGAAAGCTGATG -3'
(R):5'- TGTGAATTACAGCTCAGGGC -3'
Posted On 2020-06-30