Mutagenetix > Incidental Mutation

Incidental Mutation 'R8146:Anks6'

632799

Institutional Source

Beutler Lab

Gene Symbol

Anks6

Ensembl Gene

ENSMUSG00000066191

Gene Name

ankyrin repeat and sterile alpha motif domain containing 6

Synonyms

b2b1801.1Clo, LOC269533, 2210417J20Rik, SamCystin, Samd6

MMRRC Submission

067574-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8146 (G1)

Quality Score

199.009

Status

Not validated

Chromosome

Chromosomal Location

47015669-47057427 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 47043605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 375 (A375S)

Ref Sequence

ENSEMBL: ENSMUSP00000081665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084616] [ENSMUST00000107747] [ENSMUST00000229609]

AlphaFold

Q6GQX6

Predicted Effect

unknown
Transcript: ENSMUST00000084616
AA Change: A375S

SMART Domains

Protein: ENSMUSP00000081665
Gene: ENSMUSG00000066191
AA Change: A375S

Domain	Start	End	E-Value	Type
ANK	8	37	2.39e2	SMART
ANK	68	97	5.62e-4	SMART
ANK	101	130	2.05e-6	SMART
ANK	134	163	1.9e-1	SMART
ANK	181	210	8.99e-3	SMART
ANK	215	244	7.83e-3	SMART
ANK	282	312	5.87e2	SMART
ANK	316	345	1.22e-4	SMART
ANK	350	379	3.57e-6	SMART
ANK	383	414	1.23e3	SMART
low complexity region	539	575	N/A	INTRINSIC
low complexity region	619	673	N/A	INTRINSIC
SAM	700	766	2.73e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107747
AA Change: A375S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103376
Gene: ENSMUSG00000066191
AA Change: A375S

Domain	Start	End	E-Value	Type
ANK	8	37	2.39e2	SMART
ANK	68	97	5.62e-4	SMART
ANK	101	130	2.05e-6	SMART
ANK	134	163	1.9e-1	SMART
ANK	181	210	8.99e-3	SMART
ANK	215	244	7.83e-3	SMART
ANK	282	312	5.87e2	SMART
ANK	316	345	1.22e-4	SMART
ANK	350	379	3.57e-6	SMART
ANK	383	414	1.23e3	SMART
low complexity region	607	643	N/A	INTRINSIC
low complexity region	687	741	N/A	INTRINSIC
low complexity region	748	768	N/A	INTRINSIC
Blast:SAM	769	796	1e-9	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000229609
AA Change: A375S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and a SAM domain. It is thought that this protein may localize to the proximal region of the primary cilium, and may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart defects including TGA, DORV and septal defects associated with heterotaxy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	G	2: 19,494,003	E393A	possibly damaging	Het
4930550C14Rik	A	G	9: 53,422,970	D171G	probably damaging	Het
Abca13	T	C	11: 9,397,829	Y3561H	probably damaging	Het
Adgra2	T	A	8: 27,114,174	V464D	probably damaging	Het
Adgrl1	C	A	8: 83,930,989	T408N	possibly damaging	Het
Anks1b	G	A	10: 90,307,698	R523Q	probably damaging	Het
Bbs10	T	A	10: 111,300,535	I503K	probably benign	Het
Birc2	A	G	9: 7,818,796	I598T	probably damaging	Het
Cbl	A	T	9: 44,164,874	D339E	probably damaging	Het
Cdh4	C	A	2: 179,874,078	Q350K	possibly damaging	Het
Cep78	A	G	19: 15,956,363	L617P	probably damaging	Het
Cnbd2	T	G	2: 156,328,361	V122G	probably damaging	Het
Crem	A	T	18: 3,288,007	N158K	possibly damaging	Het
Cul1	T	C	6: 47,495,093	V56A	possibly damaging	Het
Dopey2	T	A	16: 93,749,939	I277N	possibly damaging	Het
Exoc3	T	C	13: 74,192,665	D340G	probably benign	Het
Exoc6b	A	C	6: 84,908,194	D254E	probably benign	Het
Fyttd1	A	G	16: 32,902,492	K268E	probably damaging	Het
Gbp8	T	A	5: 105,030,978	N157I	probably benign	Het
Hacd1	T	A	2: 14,044,794	S118C	probably damaging	Het
Hcn4	A	C	9: 58,823,744	E78A	unknown	Het
Inpp5e	T	A	2: 26,399,262	T549S	probably benign	Het
Kcnh4	T	C	11: 100,755,279	N281S	probably damaging	Het
Kdm5b	A	G	1: 134,625,126	D1280G	probably benign	Het
Lrfn3	A	G	7: 30,359,879	V307A	probably benign	Het
Mafb	A	G	2: 160,366,378	L100P	probably damaging	Het
Med24	C	T	11: 98,718,114	G119R	probably benign	Het
Mvp	G	T	7: 126,986,999	P866Q	probably benign	Het
Olfr630	A	G	7: 103,755,303	I94T	probably damaging	Het
Phykpl	T	C	11: 51,585,581	Y43H	probably damaging	Het
Prag1	T	G	8: 36,104,210	L649R	probably damaging	Het
Ptgdr2	T	C	19: 10,940,997	F293L	probably damaging	Het
Rasip1	T	G	7: 45,630,280	S316A	possibly damaging	Het
Rlf	G	A	4: 121,147,232	S1627L	probably benign	Het
Rtl1	T	C	12: 109,590,711	R1565G	probably benign	Het
Sart3	G	A	5: 113,747,957	T572M	probably damaging	Het
Sec24b	G	T	3: 129,995,924	S816*	probably null	Het
Slamf1	C	T	1: 171,792,319	P279L	probably benign	Het
Slc18a1	C	A	8: 69,042,749	V368F	possibly damaging	Het
Tap1	A	T	17: 34,189,232	D194V	probably damaging	Het
Tuba1c	A	G	15: 99,037,615	Y319C	probably damaging	Het
Unc79	T	A	12: 103,070,157	I579N	probably damaging	Het
Zbtb22	G	T	17: 33,916,982	V34L	probably damaging	Het

Other mutations in Anks6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Anks6	APN	4	47046054	missense	probably damaging	0.98
IGL01886:Anks6	APN	4	47044850	missense	probably damaging	1.00
IGL02903:Anks6	APN	4	47045004	missense	probably damaging	1.00
PIT4131001:Anks6	UTSW	4	47027109	missense	probably damaging	1.00
R0632:Anks6	UTSW	4	47033167	missense	possibly damaging	0.95
R1220:Anks6	UTSW	4	47025767	splice site	probably benign
R1398:Anks6	UTSW	4	47044926	missense	possibly damaging	0.75
R1479:Anks6	UTSW	4	47044874	missense	probably damaging	1.00
R1519:Anks6	UTSW	4	47027152	missense	probably damaging	0.99
R1713:Anks6	UTSW	4	47039726	missense	probably benign	0.00
R1781:Anks6	UTSW	4	47043639	missense	possibly damaging	0.87
R1853:Anks6	UTSW	4	47049387	missense	probably benign	0.00
R2364:Anks6	UTSW	4	47027248	missense	possibly damaging	0.93
R3790:Anks6	UTSW	4	47049212	missense	probably damaging	0.97
R4432:Anks6	UTSW	4	47044905	nonsense	probably null
R4700:Anks6	UTSW	4	47033127	missense	possibly damaging	0.86
R4847:Anks6	UTSW	4	47033266	missense	probably benign
R4876:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4877:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4878:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4879:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4961:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4962:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4968:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4970:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R4971:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5092:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5113:Anks6	UTSW	4	47030795	missense	probably damaging	1.00
R5389:Anks6	UTSW	4	47038900	splice site	probably benign
R5569:Anks6	UTSW	4	47045007	missense	probably damaging	1.00
R5857:Anks6	UTSW	4	47039736	missense	possibly damaging	0.92
R5977:Anks6	UTSW	4	47035748	missense	probably benign	0.11
R5978:Anks6	UTSW	4	47049252	missense	probably damaging	1.00
R6933:Anks6	UTSW	4	47049164	missense	probably benign	0.25
R7175:Anks6	UTSW	4	47046268	splice site	probably null
R7454:Anks6	UTSW	4	47038919	missense	unknown
R7874:Anks6	UTSW	4	47049275	missense	unknown
R8437:Anks6	UTSW	4	47030705	missense	probably benign	0.00
R9454:Anks6	UTSW	4	47016789	missense	possibly damaging	0.86
R9462:Anks6	UTSW	4	47033142	missense	unknown
R9567:Anks6	UTSW	4	47044880	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTTTTCTACAAATCAGCACAGGC -3'
(R):5'- TCGTTGTCCGGGAACATAGC -3'

Sequencing Primer
(F):5'- TCACTCACCAGGATCGTT -3'
(R):5'- TTCCAACCTCTGGTGAAAGG -3'

Posted On

2020-06-30