Incidental Mutation 'R8146:Cul1'
ID 632803
Institutional Source Beutler Lab
Gene Symbol Cul1
Ensembl Gene ENSMUSG00000029686
Gene Name cullin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8146 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 47453398-47526139 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47495093 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 56 (V56A)
Ref Sequence ENSEMBL: ENSMUSP00000031697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031697] [ENSMUST00000146200] [ENSMUST00000146828]
AlphaFold Q9WTX6
Predicted Effect possibly damaging
Transcript: ENSMUST00000031697
AA Change: V56A

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031697
Gene: ENSMUSG00000029686
AA Change: V56A

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-174 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Cullin_Nedd8 703 770 6.19e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146200
AA Change: V56A

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122702
Gene: ENSMUSG00000029686
AA Change: V56A

DomainStartEndE-ValueType
SCOP:d1ldja2 17 410 1e-176 SMART
CULLIN 447 594 3.69e-81 SMART
low complexity region 638 651 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146828
AA Change: V56A

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121608
Gene: ENSMUSG00000029686
AA Change: V56A

DomainStartEndE-ValueType
Pfam:Cullin 21 110 8.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations accumulate cyclin E1 and exhibit arrested development and lethality around embryonic day 6.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T G 2: 19,494,003 E393A possibly damaging Het
4930550C14Rik A G 9: 53,422,970 D171G probably damaging Het
Abca13 T C 11: 9,397,829 Y3561H probably damaging Het
Adgra2 T A 8: 27,114,174 V464D probably damaging Het
Adgrl1 C A 8: 83,930,989 T408N possibly damaging Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Anks6 C A 4: 47,043,605 A375S unknown Het
Bbs10 T A 10: 111,300,535 I503K probably benign Het
Birc2 A G 9: 7,818,796 I598T probably damaging Het
Cbl A T 9: 44,164,874 D339E probably damaging Het
Cdh4 C A 2: 179,874,078 Q350K possibly damaging Het
Cep78 A G 19: 15,956,363 L617P probably damaging Het
Cnbd2 T G 2: 156,328,361 V122G probably damaging Het
Crem A T 18: 3,288,007 N158K possibly damaging Het
Dopey2 T A 16: 93,749,939 I277N possibly damaging Het
Exoc3 T C 13: 74,192,665 D340G probably benign Het
Exoc6b A C 6: 84,908,194 D254E probably benign Het
Fyttd1 A G 16: 32,902,492 K268E probably damaging Het
Gbp8 T A 5: 105,030,978 N157I probably benign Het
Hacd1 T A 2: 14,044,794 S118C probably damaging Het
Hcn4 A C 9: 58,823,744 E78A unknown Het
Inpp5e T A 2: 26,399,262 T549S probably benign Het
Kcnh4 T C 11: 100,755,279 N281S probably damaging Het
Kdm5b A G 1: 134,625,126 D1280G probably benign Het
Lrfn3 A G 7: 30,359,879 V307A probably benign Het
Mafb A G 2: 160,366,378 L100P probably damaging Het
Med24 C T 11: 98,718,114 G119R probably benign Het
Mvp G T 7: 126,986,999 P866Q probably benign Het
Olfr630 A G 7: 103,755,303 I94T probably damaging Het
Phykpl T C 11: 51,585,581 Y43H probably damaging Het
Prag1 T G 8: 36,104,210 L649R probably damaging Het
Ptgdr2 T C 19: 10,940,997 F293L probably damaging Het
Rasip1 T G 7: 45,630,280 S316A possibly damaging Het
Rlf G A 4: 121,147,232 S1627L probably benign Het
Rtl1 T C 12: 109,590,711 R1565G probably benign Het
Sart3 G A 5: 113,747,957 T572M probably damaging Het
Sec24b G T 3: 129,995,924 S816* probably null Het
Slamf1 C T 1: 171,792,319 P279L probably benign Het
Slc18a1 C A 8: 69,042,749 V368F possibly damaging Het
Tap1 A T 17: 34,189,232 D194V probably damaging Het
Tuba1c A G 15: 99,037,615 Y319C probably damaging Het
Unc79 T A 12: 103,070,157 I579N probably damaging Het
Zbtb22 G T 17: 33,916,982 V34L probably damaging Het
Other mutations in Cul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Cul1 APN 6 47509044 missense probably benign
IGL02410:Cul1 APN 6 47485014 missense probably damaging 1.00
IGL02458:Cul1 APN 6 47525608 missense possibly damaging 0.91
IGL02490:Cul1 APN 6 47514886 missense probably damaging 0.98
IGL03065:Cul1 APN 6 47495081 missense probably damaging 1.00
IGL03387:Cul1 APN 6 47501209 missense probably damaging 0.96
IGL02837:Cul1 UTSW 6 47523205 missense probably benign 0.01
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0064:Cul1 UTSW 6 47502415 splice site probably benign
R0436:Cul1 UTSW 6 47523773 missense probably benign 0.16
R0746:Cul1 UTSW 6 47518288 splice site probably null
R1103:Cul1 UTSW 6 47517177 missense probably benign 0.03
R1471:Cul1 UTSW 6 47514886 missense probably damaging 0.98
R1746:Cul1 UTSW 6 47508245 missense probably damaging 0.98
R1852:Cul1 UTSW 6 47520830 missense probably damaging 0.99
R1858:Cul1 UTSW 6 47525524 splice site probably null
R1937:Cul1 UTSW 6 47508355 missense probably benign 0.19
R1964:Cul1 UTSW 6 47502571 missense probably damaging 0.98
R2985:Cul1 UTSW 6 47502507 missense probably damaging 1.00
R4452:Cul1 UTSW 6 47508989 nonsense probably null
R4653:Cul1 UTSW 6 47484963 missense probably damaging 1.00
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R4860:Cul1 UTSW 6 47517146 missense probably benign 0.38
R4860:Cul1 UTSW 6 47517191 missense probably damaging 0.99
R5141:Cul1 UTSW 6 47520839 missense probably benign 0.04
R5328:Cul1 UTSW 6 47508317 missense probably damaging 0.99
R5399:Cul1 UTSW 6 47485084 splice site probably null
R5593:Cul1 UTSW 6 47485086 nonsense probably null
R5593:Cul1 UTSW 6 47514991 missense probably damaging 0.99
R5616:Cul1 UTSW 6 47523788 missense probably damaging 1.00
R5855:Cul1 UTSW 6 47523213 missense probably benign 0.00
R6382:Cul1 UTSW 6 47502439 missense probably damaging 1.00
R6670:Cul1 UTSW 6 47517134 missense probably damaging 1.00
R6964:Cul1 UTSW 6 47516509 missense probably benign 0.01
R8373:Cul1 UTSW 6 47515063 missense possibly damaging 0.78
R8842:Cul1 UTSW 6 47515076 missense probably damaging 1.00
R8899:Cul1 UTSW 6 47497312 missense possibly damaging 0.84
R9093:Cul1 UTSW 6 47518239 missense probably damaging 1.00
R9352:Cul1 UTSW 6 47502492 missense probably benign 0.00
RF001:Cul1 UTSW 6 47524581 missense possibly damaging 0.50
RF055:Cul1 UTSW 6 47517133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGAACCTGTGCCACTG -3'
(R):5'- ATGCTTATACCATCGAGACATCTTACC -3'

Sequencing Primer
(F):5'- GTGTTGGGACAGATCCTCCTCAC -3'
(R):5'- CATCGAGACATCTTACCTTAAGAAG -3'
Posted On 2020-06-30