Incidental Mutation 'R8146:Olfr630'
ID632807
Institutional Source Beutler Lab
Gene Symbol Olfr630
Ensembl Gene ENSMUSG00000050281
Gene Nameolfactory receptor 630
SynonymsMOR17-1, GA_x6K02T2PBJ9-6483085-6482126
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R8146 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103753480-103757333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103755303 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 94 (I94T)
Ref Sequence ENSEMBL: ENSMUSP00000102493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106880]
Predicted Effect probably damaging
Transcript: ENSMUST00000106880
AA Change: I94T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102493
Gene: ENSMUSG00000050281
AA Change: I94T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 305 3.7e-8 PFAM
Pfam:7tm_1 43 294 8.4e-25 PFAM
Pfam:7tm_4 144 287 9e-29 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T G 2: 19,494,003 E393A possibly damaging Het
4930550C14Rik A G 9: 53,422,970 D171G probably damaging Het
Abca13 T C 11: 9,397,829 Y3561H probably damaging Het
Adgra2 T A 8: 27,114,174 V464D probably damaging Het
Adgrl1 C A 8: 83,930,989 T408N possibly damaging Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Anks6 C A 4: 47,043,605 A375S unknown Het
Bbs10 T A 10: 111,300,535 I503K probably benign Het
Birc2 A G 9: 7,818,796 I598T probably damaging Het
Cbl A T 9: 44,164,874 D339E probably damaging Het
Cdh4 C A 2: 179,874,078 Q350K possibly damaging Het
Cep78 A G 19: 15,956,363 L617P probably damaging Het
Cnbd2 T G 2: 156,328,361 V122G probably damaging Het
Crem A T 18: 3,288,007 N158K possibly damaging Het
Cul1 T C 6: 47,495,093 V56A possibly damaging Het
Dopey2 T A 16: 93,749,939 I277N possibly damaging Het
Exoc3 T C 13: 74,192,665 D340G probably benign Het
Exoc6b A C 6: 84,908,194 D254E probably benign Het
Fyttd1 A G 16: 32,902,492 K268E probably damaging Het
Gbp8 T A 5: 105,030,978 N157I probably benign Het
Hacd1 T A 2: 14,044,794 S118C probably damaging Het
Hcn4 A C 9: 58,823,744 E78A unknown Het
Inpp5e T A 2: 26,399,262 T549S probably benign Het
Kcnh4 T C 11: 100,755,279 N281S probably damaging Het
Kdm5b A G 1: 134,625,126 D1280G probably benign Het
Lrfn3 A G 7: 30,359,879 V307A probably benign Het
Mafb A G 2: 160,366,378 L100P probably damaging Het
Med24 C T 11: 98,718,114 G119R probably benign Het
Mvp G T 7: 126,986,999 P866Q probably benign Het
Phykpl T C 11: 51,585,581 Y43H probably damaging Het
Prag1 T G 8: 36,104,210 L649R probably damaging Het
Ptgdr2 T C 19: 10,940,997 F293L probably damaging Het
Rasip1 T G 7: 45,630,280 S316A possibly damaging Het
Rlf G A 4: 121,147,232 S1627L probably benign Het
Rtl1 T C 12: 109,590,711 R1565G probably benign Het
Sart3 G A 5: 113,747,957 T572M probably damaging Het
Sec24b G T 3: 129,995,924 S816* probably null Het
Slamf1 C T 1: 171,792,319 P279L probably benign Het
Slc18a1 C A 8: 69,042,749 V368F possibly damaging Het
Tap1 A T 17: 34,189,232 D194V probably damaging Het
Tuba1c A G 15: 99,037,615 Y319C probably damaging Het
Unc79 T A 12: 103,070,157 I579N probably damaging Het
Zbtb22 G T 17: 33,916,982 V34L probably damaging Het
Other mutations in Olfr630
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Olfr630 APN 7 103755006 missense probably damaging 1.00
IGL01111:Olfr630 APN 7 103755373 missense probably benign 0.07
IGL02456:Olfr630 APN 7 103755493 missense possibly damaging 0.94
IGL03173:Olfr630 APN 7 103754976 missense probably benign 0.00
R1104:Olfr630 UTSW 7 103754976 missense probably benign 0.00
R1507:Olfr630 UTSW 7 103755021 missense probably benign 0.00
R1695:Olfr630 UTSW 7 103754924 nonsense probably null
R1966:Olfr630 UTSW 7 103755168 missense probably damaging 1.00
R1971:Olfr630 UTSW 7 103755320 nonsense probably null
R2696:Olfr630 UTSW 7 103755528 missense probably damaging 0.96
R4943:Olfr630 UTSW 7 103755296 missense probably benign 0.12
R5622:Olfr630 UTSW 7 103755169 missense probably damaging 0.99
R6365:Olfr630 UTSW 7 103755195 missense probably benign 0.00
R7592:Olfr630 UTSW 7 103755072 missense probably damaging 1.00
R8283:Olfr630 UTSW 7 103754812 missense possibly damaging 0.51
R8867:Olfr630 UTSW 7 103754686 nonsense probably null
R8875:Olfr630 UTSW 7 103755255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGCAGAGCAGCAGTTC -3'
(R):5'- TGGCTATGAGGAATTTCATCACTG -3'

Sequencing Primer
(F):5'- GAGCAGCAGTTCCAATCTTG -3'
(R):5'- GAGGAATTTCATCACTGGATTTCC -3'
Posted On2020-06-30