Incidental Mutation 'R0102:Ube2u'
ID63282
Institutional Source Beutler Lab
Gene Symbol Ube2u
Ensembl Gene ENSMUSG00000069733
Gene Nameubiquitin-conjugating enzyme E2U (putative)
Synonyms
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0102 (G1)
Quality Score165
Status Validated
Chromosome4
Chromosomal Location100478849-100550147 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100549925 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 215 (T215A)
Ref Sequence ENSEMBL: ENSMUSP00000090406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092730] [ENSMUST00000133493]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092730
AA Change: T215A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090406
Gene: ENSMUSG00000069733
AA Change: T215A

DomainStartEndE-ValueType
Blast:UBCc 1 40 4e-17 BLAST
coiled coil region 147 189 N/A INTRINSIC
low complexity region 196 207 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133493
AA Change: T328A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137472
Gene: ENSMUSG00000069733
AA Change: T328A

DomainStartEndE-ValueType
UBCc 7 153 1.58e-25 SMART
coiled coil region 260 302 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
Meta Mutation Damage Score 0.1302 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Ube2u
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Ube2u APN 4 100479225 missense possibly damaging 0.77
IGL01641:Ube2u APN 4 100481657 missense probably benign 0.02
IGL02633:Ube2u APN 4 100482774 splice site probably benign
IGL03126:Ube2u APN 4 100550002 makesense probably null
IGL03358:Ube2u APN 4 100547275 splice site probably benign
R0043:Ube2u UTSW 4 100482829 missense possibly damaging 0.93
R0102:Ube2u UTSW 4 100549925 missense possibly damaging 0.66
R0110:Ube2u UTSW 4 100486673 missense probably benign 0.01
R0113:Ube2u UTSW 4 100481655 missense possibly damaging 0.93
R0357:Ube2u UTSW 4 100481654 nonsense probably null
R0395:Ube2u UTSW 4 100481648 missense probably benign 0.02
R0465:Ube2u UTSW 4 100532096 splice site probably benign
R0469:Ube2u UTSW 4 100486673 missense probably benign 0.01
R0788:Ube2u UTSW 4 100514740 splice site probably benign
R1958:Ube2u UTSW 4 100481636 missense probably benign
R2216:Ube2u UTSW 4 100532168 missense probably benign 0.00
R2937:Ube2u UTSW 4 100524298 missense possibly damaging 0.93
R4086:Ube2u UTSW 4 100549842 missense probably benign 0.18
R4471:Ube2u UTSW 4 100481646 nonsense probably null
R4781:Ube2u UTSW 4 100486658 missense probably benign 0.08
R6385:Ube2u UTSW 4 100532144 missense possibly damaging 0.91
R6912:Ube2u UTSW 4 100532155 missense probably damaging 0.99
R7382:Ube2u UTSW 4 100532182 nonsense probably null
Z1176:Ube2u UTSW 4 100482840 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATATGACTGTGAGCCAGCGCAT -3'
(R):5'- GCCAGGTCCTGAGCATCTCCTAAAA -3'

Sequencing Primer
(F):5'- gcattcgcatccatatacataaacac -3'
(R):5'- TAAAACTGTTCCCTGAGACTGC -3'
Posted On2013-07-30