Mutagenetix > Incidental Mutation

Incidental Mutation 'R8146:Rtl1'

632824

Institutional Source

Beutler Lab

Gene Symbol

Rtl1

Ensembl Gene

ENSMUSG00000085925

Gene Name

retrotransposon Gaglike 1

Synonyms

Mart1, Mor1, Mar

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8146 (G1)

Quality Score

157.009

Status

Not validated

Chromosome

Chromosomal Location

109589193-109600330 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109590711 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1565 (R1565G)

Ref Sequence

ENSEMBL: ENSMUSP00000115957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000149046]

AlphaFold

Q7M732

Predicted Effect

probably benign
Transcript: ENSMUST00000149046
AA Change: R1565G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: R1565G

Domain	Start	End	E-Value	Type
low complexity region	19	30	N/A	INTRINSIC
low complexity region	41	80	N/A	INTRINSIC
internal_repeat_1	88	163	8.8e-50	PROSPERO
internal_repeat_1	176	251	8.8e-50	PROSPERO
low complexity region	332	361	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
low complexity region	393	408	N/A	INTRINSIC
Pfam:DUF4939	432	538	1.6e-14	PFAM
Pfam:Retrotrans_gag	493	586	9.2e-13	PFAM
low complexity region	611	632	N/A	INTRINSIC
Pfam:gag-asp_proteas	663	731	2.3e-15	PFAM
low complexity region	833	849	N/A	INTRINSIC
low complexity region	878	892	N/A	INTRINSIC
PDB:4OL8\|E	988	1192	6e-17	PDB
Blast:CYCc	989	1158	5e-9	BLAST
SCOP:d1sig__	1291	1443	2e-4	SMART
low complexity region	1733	1744	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	G	2: 19,494,003	E393A	possibly damaging	Het
4930550C14Rik	A	G	9: 53,422,970	D171G	probably damaging	Het
Abca13	T	C	11: 9,397,829	Y3561H	probably damaging	Het
Adgra2	T	A	8: 27,114,174	V464D	probably damaging	Het
Adgrl1	C	A	8: 83,930,989	T408N	possibly damaging	Het
Anks1b	G	A	10: 90,307,698	R523Q	probably damaging	Het
Anks6	C	A	4: 47,043,605	A375S	unknown	Het
Bbs10	T	A	10: 111,300,535	I503K	probably benign	Het
Birc2	A	G	9: 7,818,796	I598T	probably damaging	Het
Cbl	A	T	9: 44,164,874	D339E	probably damaging	Het
Cdh4	C	A	2: 179,874,078	Q350K	possibly damaging	Het
Cep78	A	G	19: 15,956,363	L617P	probably damaging	Het
Cnbd2	T	G	2: 156,328,361	V122G	probably damaging	Het
Crem	A	T	18: 3,288,007	N158K	possibly damaging	Het
Cul1	T	C	6: 47,495,093	V56A	possibly damaging	Het
Dopey2	T	A	16: 93,749,939	I277N	possibly damaging	Het
Exoc3	T	C	13: 74,192,665	D340G	probably benign	Het
Exoc6b	A	C	6: 84,908,194	D254E	probably benign	Het
Fyttd1	A	G	16: 32,902,492	K268E	probably damaging	Het
Gbp8	T	A	5: 105,030,978	N157I	probably benign	Het
Hacd1	T	A	2: 14,044,794	S118C	probably damaging	Het
Hcn4	A	C	9: 58,823,744	E78A	unknown	Het
Inpp5e	T	A	2: 26,399,262	T549S	probably benign	Het
Kcnh4	T	C	11: 100,755,279	N281S	probably damaging	Het
Kdm5b	A	G	1: 134,625,126	D1280G	probably benign	Het
Lrfn3	A	G	7: 30,359,879	V307A	probably benign	Het
Mafb	A	G	2: 160,366,378	L100P	probably damaging	Het
Med24	C	T	11: 98,718,114	G119R	probably benign	Het
Mvp	G	T	7: 126,986,999	P866Q	probably benign	Het
Olfr630	A	G	7: 103,755,303	I94T	probably damaging	Het
Phykpl	T	C	11: 51,585,581	Y43H	probably damaging	Het
Prag1	T	G	8: 36,104,210	L649R	probably damaging	Het
Ptgdr2	T	C	19: 10,940,997	F293L	probably damaging	Het
Rasip1	T	G	7: 45,630,280	S316A	possibly damaging	Het
Rlf	G	A	4: 121,147,232	S1627L	probably benign	Het
Sart3	G	A	5: 113,747,957	T572M	probably damaging	Het
Sec24b	G	T	3: 129,995,924	S816*	probably null	Het
Slamf1	C	T	1: 171,792,319	P279L	probably benign	Het
Slc18a1	C	A	8: 69,042,749	V368F	possibly damaging	Het
Tap1	A	T	17: 34,189,232	D194V	probably damaging	Het
Tuba1c	A	G	15: 99,037,615	Y319C	probably damaging	Het
Unc79	T	A	12: 103,070,157	I579N	probably damaging	Het
Zbtb22	G	T	17: 33,916,982	V34L	probably damaging	Het

Other mutations in Rtl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Rtl1	APN	12	109593000	missense	probably benign	0.00
IGL01981:Rtl1	APN	12	109591935	missense	possibly damaging	0.72
IGL02418:Rtl1	APN	12	109590449	missense	probably damaging	1.00
IGL03164:Rtl1	APN	12	109592933	missense	probably damaging	1.00
FR4304:Rtl1	UTSW	12	109591198	small deletion	probably benign
R0109:Rtl1	UTSW	12	109595407	start gained	probably benign
R0141:Rtl1	UTSW	12	109592948	missense	probably damaging	1.00
R0312:Rtl1	UTSW	12	109590227	missense	probably damaging	0.99
R0389:Rtl1	UTSW	12	109590363	missense	possibly damaging	0.77
R0390:Rtl1	UTSW	12	109591386	missense	unknown
R0548:Rtl1	UTSW	12	109591655	missense	probably damaging	0.98
R0561:Rtl1	UTSW	12	109593929	missense	probably damaging	0.99
R0624:Rtl1	UTSW	12	109592719	missense	probably damaging	0.97
R0746:Rtl1	UTSW	12	109592960	missense	probably damaging	1.00
R1353:Rtl1	UTSW	12	109592199	missense	probably benign	0.00
R1868:Rtl1	UTSW	12	109590536	missense	probably damaging	1.00
R1935:Rtl1	UTSW	12	109591920	missense	probably benign	0.42
R2000:Rtl1	UTSW	12	109593887	missense	probably damaging	1.00
R2094:Rtl1	UTSW	12	109591397	missense	unknown
R2125:Rtl1	UTSW	12	109593921	missense	possibly damaging	0.64
R2166:Rtl1	UTSW	12	109590554	missense	probably damaging	1.00
R2247:Rtl1	UTSW	12	109594979	missense	possibly damaging	0.77
R2274:Rtl1	UTSW	12	109594667	missense	unknown
R2919:Rtl1	UTSW	12	109591148	missense	unknown
R2998:Rtl1	UTSW	12	109595096	missense	probably damaging	0.99
R4554:Rtl1	UTSW	12	109594328	missense	possibly damaging	0.53
R4566:Rtl1	UTSW	12	109592859	missense	probably damaging	1.00
R4887:Rtl1	UTSW	12	109591704	missense	probably damaging	0.96
R5399:Rtl1	UTSW	12	109590302	missense	probably damaging	1.00
R5512:Rtl1	UTSW	12	109591371	missense	unknown
R5616:Rtl1	UTSW	12	109592739	missense	unknown
R5644:Rtl1	UTSW	12	109591579	missense	probably benign	0.03
R5647:Rtl1	UTSW	12	109594679	missense	unknown
R5695:Rtl1	UTSW	12	109594097	missense	probably damaging	1.00
R5714:Rtl1	UTSW	12	109593680	missense	probably damaging	0.99
R5786:Rtl1	UTSW	12	109592619	missense	possibly damaging	0.89
R5917:Rtl1	UTSW	12	109591653	missense	possibly damaging	0.82
R5948:Rtl1	UTSW	12	109590599	missense	possibly damaging	0.86
R6051:Rtl1	UTSW	12	109593024	missense	probably damaging	1.00
R6251:Rtl1	UTSW	12	109593649	missense	probably benign	0.16
R6342:Rtl1	UTSW	12	109592301	missense	possibly damaging	0.50
R6433:Rtl1	UTSW	12	109595196	missense	unknown
R6815:Rtl1	UTSW	12	109594503	missense	probably damaging	0.98
R6968:Rtl1	UTSW	12	109594679	missense	unknown
R7002:Rtl1	UTSW	12	109593947	missense	probably damaging	0.97
R7020:Rtl1	UTSW	12	109592315	missense	possibly damaging	0.72
R7026:Rtl1	UTSW	12	109593161	missense	probably damaging	0.99
R7027:Rtl1	UTSW	12	109591414	small deletion	probably benign
R7196:Rtl1	UTSW	12	109592787	missense	possibly damaging	0.83
R7239:Rtl1	UTSW	12	109592475	missense	probably benign	0.05
R7312:Rtl1	UTSW	12	109595238	missense	unknown
R7476:Rtl1	UTSW	12	109591105	missense	unknown
R7589:Rtl1	UTSW	12	109593845	missense	possibly damaging	0.91
R7655:Rtl1	UTSW	12	109591008	missense	unknown
R7656:Rtl1	UTSW	12	109591008	missense	unknown
R7657:Rtl1	UTSW	12	109595384	missense	possibly damaging	0.94
R7720:Rtl1	UTSW	12	109594430	missense	possibly damaging	0.96
R7772:Rtl1	UTSW	12	109593185	missense	probably damaging	1.00
R7840:Rtl1	UTSW	12	109594155	missense	probably benign	0.08
R7890:Rtl1	UTSW	12	109592817	missense	possibly damaging	0.57
R7893:Rtl1	UTSW	12	109593921	missense	possibly damaging	0.64
R7894:Rtl1	UTSW	12	109594597	missense	possibly damaging	0.70
R7909:Rtl1	UTSW	12	109590177	missense	unknown
R7909:Rtl1	UTSW	12	109592480	missense	possibly damaging	0.95
R7986:Rtl1	UTSW	12	109592058	missense	possibly damaging	0.95
R8007:Rtl1	UTSW	12	109591626	missense	possibly damaging	0.86
R8193:Rtl1	UTSW	12	109592216	missense	probably benign	0.03
R8263:Rtl1	UTSW	12	109593746	missense	probably damaging	0.99
R8273:Rtl1	UTSW	12	109592715	missense	possibly damaging	0.92
R8512:Rtl1	UTSW	12	109594617	missense	unknown
R8514:Rtl1	UTSW	12	109593873	missense	possibly damaging	0.52
R8748:Rtl1	UTSW	12	109595058	missense	probably benign	0.39
R9036:Rtl1	UTSW	12	109593257	missense	probably benign	0.03
R9104:Rtl1	UTSW	12	109594284	missense	probably benign	0.21
R9151:Rtl1	UTSW	12	109593573	missense
R9238:Rtl1	UTSW	12	109594583	missense	possibly damaging	0.72
R9292:Rtl1	UTSW	12	109590239	missense	possibly damaging	0.91
R9329:Rtl1	UTSW	12	109590239	missense	possibly damaging	0.91
R9332:Rtl1	UTSW	12	109590857	missense	probably benign	0.01
R9342:Rtl1	UTSW	12	109592450	missense	probably damaging	1.00
R9350:Rtl1	UTSW	12	109590792	nonsense	probably null
R9446:Rtl1	UTSW	12	109590170	makesense	probably null
R9523:Rtl1	UTSW	12	109594679	missense	unknown
R9524:Rtl1	UTSW	12	109590539	missense	probably damaging	1.00
R9535:Rtl1	UTSW	12	109590737	missense	probably damaging	1.00
R9535:Rtl1	UTSW	12	109595264	missense	unknown
R9564:Rtl1	UTSW	12	109590279	missense	probably benign	0.19
R9615:Rtl1	UTSW	12	109590401	missense	possibly damaging	0.65
R9661:Rtl1	UTSW	12	109590912	missense	possibly damaging	0.79
R9674:Rtl1	UTSW	12	109592590	missense	possibly damaging	0.50
R9720:Rtl1	UTSW	12	109593448	missense	possibly damaging	0.50
Z1088:Rtl1	UTSW	12	109592319	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AACGTTGCAGGTCGTCTTG -3'
(R):5'- GCCCCTAATTTGGAAGTGGC -3'

Sequencing Primer
(F):5'- TTGCAGGGCTTCTCGCAAG -3'
(R):5'- CCTAATTTGGAAGTGGCCAGGC -3'

Posted On

2020-06-30