Incidental Mutation 'R8146:Rtl1'
ID 632824
Institutional Source Beutler Lab
Gene Symbol Rtl1
Ensembl Gene ENSMUSG00000085925
Gene Name retrotransposon Gaglike 1
Synonyms Mart1, Mor1, Mar
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8146 (G1)
Quality Score 157.009
Status Not validated
Chromosome 12
Chromosomal Location 109589193-109600330 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109590711 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 1565 (R1565G)
Ref Sequence ENSEMBL: ENSMUSP00000115957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149046]
AlphaFold Q7M732
Predicted Effect probably benign
Transcript: ENSMUST00000149046
AA Change: R1565G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: R1565G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 41 80 N/A INTRINSIC
internal_repeat_1 88 163 8.8e-50 PROSPERO
internal_repeat_1 176 251 8.8e-50 PROSPERO
low complexity region 332 361 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 393 408 N/A INTRINSIC
Pfam:DUF4939 432 538 1.6e-14 PFAM
Pfam:Retrotrans_gag 493 586 9.2e-13 PFAM
low complexity region 611 632 N/A INTRINSIC
Pfam:gag-asp_proteas 663 731 2.3e-15 PFAM
low complexity region 833 849 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
PDB:4OL8|E 988 1192 6e-17 PDB
Blast:CYCc 989 1158 5e-9 BLAST
SCOP:d1sig__ 1291 1443 2e-4 SMART
low complexity region 1733 1744 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T G 2: 19,494,003 E393A possibly damaging Het
4930550C14Rik A G 9: 53,422,970 D171G probably damaging Het
Abca13 T C 11: 9,397,829 Y3561H probably damaging Het
Adgra2 T A 8: 27,114,174 V464D probably damaging Het
Adgrl1 C A 8: 83,930,989 T408N possibly damaging Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Anks6 C A 4: 47,043,605 A375S unknown Het
Bbs10 T A 10: 111,300,535 I503K probably benign Het
Birc2 A G 9: 7,818,796 I598T probably damaging Het
Cbl A T 9: 44,164,874 D339E probably damaging Het
Cdh4 C A 2: 179,874,078 Q350K possibly damaging Het
Cep78 A G 19: 15,956,363 L617P probably damaging Het
Cnbd2 T G 2: 156,328,361 V122G probably damaging Het
Crem A T 18: 3,288,007 N158K possibly damaging Het
Cul1 T C 6: 47,495,093 V56A possibly damaging Het
Dopey2 T A 16: 93,749,939 I277N possibly damaging Het
Exoc3 T C 13: 74,192,665 D340G probably benign Het
Exoc6b A C 6: 84,908,194 D254E probably benign Het
Fyttd1 A G 16: 32,902,492 K268E probably damaging Het
Gbp8 T A 5: 105,030,978 N157I probably benign Het
Hacd1 T A 2: 14,044,794 S118C probably damaging Het
Hcn4 A C 9: 58,823,744 E78A unknown Het
Inpp5e T A 2: 26,399,262 T549S probably benign Het
Kcnh4 T C 11: 100,755,279 N281S probably damaging Het
Kdm5b A G 1: 134,625,126 D1280G probably benign Het
Lrfn3 A G 7: 30,359,879 V307A probably benign Het
Mafb A G 2: 160,366,378 L100P probably damaging Het
Med24 C T 11: 98,718,114 G119R probably benign Het
Mvp G T 7: 126,986,999 P866Q probably benign Het
Olfr630 A G 7: 103,755,303 I94T probably damaging Het
Phykpl T C 11: 51,585,581 Y43H probably damaging Het
Prag1 T G 8: 36,104,210 L649R probably damaging Het
Ptgdr2 T C 19: 10,940,997 F293L probably damaging Het
Rasip1 T G 7: 45,630,280 S316A possibly damaging Het
Rlf G A 4: 121,147,232 S1627L probably benign Het
Sart3 G A 5: 113,747,957 T572M probably damaging Het
Sec24b G T 3: 129,995,924 S816* probably null Het
Slamf1 C T 1: 171,792,319 P279L probably benign Het
Slc18a1 C A 8: 69,042,749 V368F possibly damaging Het
Tap1 A T 17: 34,189,232 D194V probably damaging Het
Tuba1c A G 15: 99,037,615 Y319C probably damaging Het
Unc79 T A 12: 103,070,157 I579N probably damaging Het
Zbtb22 G T 17: 33,916,982 V34L probably damaging Het
Other mutations in Rtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rtl1 APN 12 109593000 missense probably benign 0.00
IGL01981:Rtl1 APN 12 109591935 missense possibly damaging 0.72
IGL02418:Rtl1 APN 12 109590449 missense probably damaging 1.00
IGL03164:Rtl1 APN 12 109592933 missense probably damaging 1.00
FR4304:Rtl1 UTSW 12 109591198 small deletion probably benign
R0109:Rtl1 UTSW 12 109595407 start gained probably benign
R0141:Rtl1 UTSW 12 109592948 missense probably damaging 1.00
R0312:Rtl1 UTSW 12 109590227 missense probably damaging 0.99
R0389:Rtl1 UTSW 12 109590363 missense possibly damaging 0.77
R0390:Rtl1 UTSW 12 109591386 missense unknown
R0548:Rtl1 UTSW 12 109591655 missense probably damaging 0.98
R0561:Rtl1 UTSW 12 109593929 missense probably damaging 0.99
R0624:Rtl1 UTSW 12 109592719 missense probably damaging 0.97
R0746:Rtl1 UTSW 12 109592960 missense probably damaging 1.00
R1353:Rtl1 UTSW 12 109592199 missense probably benign 0.00
R1868:Rtl1 UTSW 12 109590536 missense probably damaging 1.00
R1935:Rtl1 UTSW 12 109591920 missense probably benign 0.42
R2000:Rtl1 UTSW 12 109593887 missense probably damaging 1.00
R2094:Rtl1 UTSW 12 109591397 missense unknown
R2125:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R2166:Rtl1 UTSW 12 109590554 missense probably damaging 1.00
R2247:Rtl1 UTSW 12 109594979 missense possibly damaging 0.77
R2274:Rtl1 UTSW 12 109594667 missense unknown
R2919:Rtl1 UTSW 12 109591148 missense unknown
R2998:Rtl1 UTSW 12 109595096 missense probably damaging 0.99
R4554:Rtl1 UTSW 12 109594328 missense possibly damaging 0.53
R4566:Rtl1 UTSW 12 109592859 missense probably damaging 1.00
R4887:Rtl1 UTSW 12 109591704 missense probably damaging 0.96
R5399:Rtl1 UTSW 12 109590302 missense probably damaging 1.00
R5512:Rtl1 UTSW 12 109591371 missense unknown
R5616:Rtl1 UTSW 12 109592739 missense unknown
R5644:Rtl1 UTSW 12 109591579 missense probably benign 0.03
R5647:Rtl1 UTSW 12 109594679 missense unknown
R5695:Rtl1 UTSW 12 109594097 missense probably damaging 1.00
R5714:Rtl1 UTSW 12 109593680 missense probably damaging 0.99
R5786:Rtl1 UTSW 12 109592619 missense possibly damaging 0.89
R5917:Rtl1 UTSW 12 109591653 missense possibly damaging 0.82
R5948:Rtl1 UTSW 12 109590599 missense possibly damaging 0.86
R6051:Rtl1 UTSW 12 109593024 missense probably damaging 1.00
R6251:Rtl1 UTSW 12 109593649 missense probably benign 0.16
R6342:Rtl1 UTSW 12 109592301 missense possibly damaging 0.50
R6433:Rtl1 UTSW 12 109595196 missense unknown
R6815:Rtl1 UTSW 12 109594503 missense probably damaging 0.98
R6968:Rtl1 UTSW 12 109594679 missense unknown
R7002:Rtl1 UTSW 12 109593947 missense probably damaging 0.97
R7020:Rtl1 UTSW 12 109592315 missense possibly damaging 0.72
R7026:Rtl1 UTSW 12 109593161 missense probably damaging 0.99
R7027:Rtl1 UTSW 12 109591414 small deletion probably benign
R7196:Rtl1 UTSW 12 109592787 missense possibly damaging 0.83
R7239:Rtl1 UTSW 12 109592475 missense probably benign 0.05
R7312:Rtl1 UTSW 12 109595238 missense unknown
R7476:Rtl1 UTSW 12 109591105 missense unknown
R7589:Rtl1 UTSW 12 109593845 missense possibly damaging 0.91
R7655:Rtl1 UTSW 12 109591008 missense unknown
R7656:Rtl1 UTSW 12 109591008 missense unknown
R7657:Rtl1 UTSW 12 109595384 missense possibly damaging 0.94
R7720:Rtl1 UTSW 12 109594430 missense possibly damaging 0.96
R7772:Rtl1 UTSW 12 109593185 missense probably damaging 1.00
R7840:Rtl1 UTSW 12 109594155 missense probably benign 0.08
R7890:Rtl1 UTSW 12 109592817 missense possibly damaging 0.57
R7893:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R7894:Rtl1 UTSW 12 109594597 missense possibly damaging 0.70
R7909:Rtl1 UTSW 12 109590177 missense unknown
R7909:Rtl1 UTSW 12 109592480 missense possibly damaging 0.95
R7986:Rtl1 UTSW 12 109592058 missense possibly damaging 0.95
R8007:Rtl1 UTSW 12 109591626 missense possibly damaging 0.86
R8193:Rtl1 UTSW 12 109592216 missense probably benign 0.03
R8263:Rtl1 UTSW 12 109593746 missense probably damaging 0.99
R8273:Rtl1 UTSW 12 109592715 missense possibly damaging 0.92
R8512:Rtl1 UTSW 12 109594617 missense unknown
R8514:Rtl1 UTSW 12 109593873 missense possibly damaging 0.52
R8748:Rtl1 UTSW 12 109595058 missense probably benign 0.39
R9036:Rtl1 UTSW 12 109593257 missense probably benign 0.03
R9104:Rtl1 UTSW 12 109594284 missense probably benign 0.21
R9151:Rtl1 UTSW 12 109593573 missense
R9238:Rtl1 UTSW 12 109594583 missense possibly damaging 0.72
R9292:Rtl1 UTSW 12 109590239 missense possibly damaging 0.91
R9329:Rtl1 UTSW 12 109590239 missense possibly damaging 0.91
R9332:Rtl1 UTSW 12 109590857 missense probably benign 0.01
R9342:Rtl1 UTSW 12 109592450 missense probably damaging 1.00
R9350:Rtl1 UTSW 12 109590792 nonsense probably null
R9446:Rtl1 UTSW 12 109590170 makesense probably null
R9523:Rtl1 UTSW 12 109594679 missense unknown
R9524:Rtl1 UTSW 12 109590539 missense probably damaging 1.00
R9535:Rtl1 UTSW 12 109590737 missense probably damaging 1.00
R9535:Rtl1 UTSW 12 109595264 missense unknown
R9564:Rtl1 UTSW 12 109590279 missense probably benign 0.19
R9615:Rtl1 UTSW 12 109590401 missense possibly damaging 0.65
R9661:Rtl1 UTSW 12 109590912 missense possibly damaging 0.79
R9674:Rtl1 UTSW 12 109592590 missense possibly damaging 0.50
R9720:Rtl1 UTSW 12 109593448 missense possibly damaging 0.50
Z1088:Rtl1 UTSW 12 109592319 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACGTTGCAGGTCGTCTTG -3'
(R):5'- GCCCCTAATTTGGAAGTGGC -3'

Sequencing Primer
(F):5'- TTGCAGGGCTTCTCGCAAG -3'
(R):5'- CCTAATTTGGAAGTGGCCAGGC -3'
Posted On 2020-06-30