Incidental Mutation 'R8146:Exoc3'
ID632825
Institutional Source Beutler Lab
Gene Symbol Exoc3
Ensembl Gene ENSMUSG00000034152
Gene Nameexocyst complex component 3
SynonymsSec6l1, E430013E20Rik, 2810050O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R8146 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location74169488-74208732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74192665 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 340 (D340G)
Ref Sequence ENSEMBL: ENSMUSP00000039416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035934] [ENSMUST00000222213]
Predicted Effect probably benign
Transcript: ENSMUST00000035934
AA Change: D340G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039416
Gene: ENSMUSG00000034152
AA Change: D340G

DomainStartEndE-ValueType
Pfam:Sec6 187 743 1.7e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222213
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T G 2: 19,494,003 E393A possibly damaging Het
4930550C14Rik A G 9: 53,422,970 D171G probably damaging Het
Abca13 T C 11: 9,397,829 Y3561H probably damaging Het
Adgra2 T A 8: 27,114,174 V464D probably damaging Het
Adgrl1 C A 8: 83,930,989 T408N possibly damaging Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Anks6 C A 4: 47,043,605 A375S unknown Het
Bbs10 T A 10: 111,300,535 I503K probably benign Het
Birc2 A G 9: 7,818,796 I598T probably damaging Het
Cbl A T 9: 44,164,874 D339E probably damaging Het
Cdh4 C A 2: 179,874,078 Q350K possibly damaging Het
Cep78 A G 19: 15,956,363 L617P probably damaging Het
Cnbd2 T G 2: 156,328,361 V122G probably damaging Het
Crem A T 18: 3,288,007 N158K possibly damaging Het
Cul1 T C 6: 47,495,093 V56A possibly damaging Het
Dopey2 T A 16: 93,749,939 I277N possibly damaging Het
Exoc6b A C 6: 84,908,194 D254E probably benign Het
Fyttd1 A G 16: 32,902,492 K268E probably damaging Het
Gbp8 T A 5: 105,030,978 N157I probably benign Het
Hacd1 T A 2: 14,044,794 S118C probably damaging Het
Hcn4 A C 9: 58,823,744 E78A unknown Het
Inpp5e T A 2: 26,399,262 T549S probably benign Het
Kcnh4 T C 11: 100,755,279 N281S probably damaging Het
Kdm5b A G 1: 134,625,126 D1280G probably benign Het
Lrfn3 A G 7: 30,359,879 V307A probably benign Het
Mafb A G 2: 160,366,378 L100P probably damaging Het
Med24 C T 11: 98,718,114 G119R probably benign Het
Mvp G T 7: 126,986,999 P866Q probably benign Het
Olfr630 A G 7: 103,755,303 I94T probably damaging Het
Phykpl T C 11: 51,585,581 Y43H probably damaging Het
Prag1 T G 8: 36,104,210 L649R probably damaging Het
Ptgdr2 T C 19: 10,940,997 F293L probably damaging Het
Rasip1 T G 7: 45,630,280 S316A possibly damaging Het
Rlf G A 4: 121,147,232 S1627L probably benign Het
Rtl1 T C 12: 109,590,711 R1565G probably benign Het
Sart3 G A 5: 113,747,957 T572M probably damaging Het
Sec24b G T 3: 129,995,924 S816* probably null Het
Slamf1 C T 1: 171,792,319 P279L probably benign Het
Slc18a1 C A 8: 69,042,749 V368F possibly damaging Het
Tap1 A T 17: 34,189,232 D194V probably damaging Het
Tuba1c A G 15: 99,037,615 Y319C probably damaging Het
Unc79 T A 12: 103,070,157 I579N probably damaging Het
Zbtb22 G T 17: 33,916,982 V34L probably damaging Het
Other mutations in Exoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Exoc3 APN 13 74206906 critical splice donor site probably null
IGL01444:Exoc3 APN 13 74206935 missense probably damaging 1.00
IGL02095:Exoc3 APN 13 74180536 missense probably damaging 1.00
IGL02370:Exoc3 APN 13 74192761 missense probably benign 0.02
IGL02704:Exoc3 APN 13 74174144 missense probably benign 0.00
IGL03113:Exoc3 APN 13 74193113 nonsense probably null
R0037:Exoc3 UTSW 13 74199539 missense probably damaging 0.99
R0565:Exoc3 UTSW 13 74182275 critical splice donor site probably null
R1282:Exoc3 UTSW 13 74182292 missense probably benign 0.30
R1438:Exoc3 UTSW 13 74190179 missense probably damaging 1.00
R1694:Exoc3 UTSW 13 74190065 splice site probably null
R1913:Exoc3 UTSW 13 74182316 missense probably damaging 1.00
R1915:Exoc3 UTSW 13 74173294 critical splice donor site probably null
R2039:Exoc3 UTSW 13 74192977 missense probably benign
R4272:Exoc3 UTSW 13 74192644 missense probably damaging 1.00
R4852:Exoc3 UTSW 13 74199645 missense probably damaging 1.00
R5698:Exoc3 UTSW 13 74174015 missense probably benign 0.13
R5909:Exoc3 UTSW 13 74199524 missense probably damaging 0.98
R5969:Exoc3 UTSW 13 74172186 nonsense probably null
R6248:Exoc3 UTSW 13 74182281 missense probably benign 0.40
R6433:Exoc3 UTSW 13 74189187 missense possibly damaging 0.93
R6599:Exoc3 UTSW 13 74189158 splice site probably null
R6861:Exoc3 UTSW 13 74189200 missense probably benign
R7000:Exoc3 UTSW 13 74182166 missense probably benign 0.41
R7384:Exoc3 UTSW 13 74172156 missense probably benign 0.00
R8098:Exoc3 UTSW 13 74172152 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATAAGTCACCAGCAGGCAG -3'
(R):5'- GGCAGACACCAGAGAATCTG -3'

Sequencing Primer
(F):5'- GTCACCAGCAGGCAGAACAG -3'
(R):5'- AGAGAATCTGACAAGATGTGGC -3'
Posted On2020-06-30