Incidental Mutation 'R8146:Tap1'
ID 632830
Institutional Source Beutler Lab
Gene Symbol Tap1
Ensembl Gene ENSMUSG00000037321
Gene Name transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms TAP, Ham1, RING4, MTP1, Tap-1, Ham-1, Abcb2, PSF-1
MMRRC Submission 067574-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8146 (G1)
Quality Score 216.009
Status Not validated
Chromosome 17
Chromosomal Location 34406530-34416199 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34408206 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 194 (D194V)
Ref Sequence ENSEMBL: ENSMUSP00000128401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041633] [ENSMUST00000170086] [ENSMUST00000173831] [ENSMUST00000174576]
AlphaFold P21958
Predicted Effect probably damaging
Transcript: ENSMUST00000041633
AA Change: D194V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321
AA Change: D194V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170086
AA Change: D194V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321
AA Change: D194V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171148
SMART Domains Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321

DomainStartEndE-ValueType
Pfam:ABC_membrane 1 114 1.5e-24 PFAM
Pfam:ABC_tran 167 196 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173831
SMART Domains Protein: ENSMUSP00000134120
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 1 64 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174576
SMART Domains Protein: ENSMUSP00000133499
Gene: ENSMUSG00000096727

DomainStartEndE-ValueType
Pfam:Proteasome 17 198 1.2e-45 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
Allele List at MGI
All alleles(2) : Targeted, knock-out(2)
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T G 2: 19,498,814 (GRCm39) E393A possibly damaging Het
4930550C14Rik A G 9: 53,334,270 (GRCm39) D171G probably damaging Het
Abca13 T C 11: 9,347,829 (GRCm39) Y3561H probably damaging Het
Adgra2 T A 8: 27,604,202 (GRCm39) V464D probably damaging Het
Adgrl1 C A 8: 84,657,618 (GRCm39) T408N possibly damaging Het
Anks1b G A 10: 90,143,560 (GRCm39) R523Q probably damaging Het
Anks6 C A 4: 47,043,605 (GRCm39) A375S unknown Het
Bbs10 T A 10: 111,136,396 (GRCm39) I503K probably benign Het
Birc2 A G 9: 7,818,797 (GRCm39) I598T probably damaging Het
Cbl A T 9: 44,076,171 (GRCm39) D339E probably damaging Het
Cdh4 C A 2: 179,515,871 (GRCm39) Q350K possibly damaging Het
Cep78 A G 19: 15,933,727 (GRCm39) L617P probably damaging Het
Cnbd2 T G 2: 156,170,281 (GRCm39) V122G probably damaging Het
Crem A T 18: 3,288,007 (GRCm39) N158K possibly damaging Het
Cul1 T C 6: 47,472,027 (GRCm39) V56A possibly damaging Het
Dop1b T A 16: 93,546,827 (GRCm39) I277N possibly damaging Het
Exoc3 T C 13: 74,340,784 (GRCm39) D340G probably benign Het
Exoc6b A C 6: 84,885,176 (GRCm39) D254E probably benign Het
Fyttd1 A G 16: 32,722,862 (GRCm39) K268E probably damaging Het
Gbp8 T A 5: 105,178,844 (GRCm39) N157I probably benign Het
Hacd1 T A 2: 14,049,605 (GRCm39) S118C probably damaging Het
Hcn4 A C 9: 58,731,027 (GRCm39) E78A unknown Het
Inpp5e T A 2: 26,289,274 (GRCm39) T549S probably benign Het
Kcnh4 T C 11: 100,646,105 (GRCm39) N281S probably damaging Het
Kdm5b A G 1: 134,552,864 (GRCm39) D1280G probably benign Het
Lrfn3 A G 7: 30,059,304 (GRCm39) V307A probably benign Het
Mafb A G 2: 160,208,298 (GRCm39) L100P probably damaging Het
Med24 C T 11: 98,608,940 (GRCm39) G119R probably benign Het
Mvp G T 7: 126,586,171 (GRCm39) P866Q probably benign Het
Or51l4 A G 7: 103,404,510 (GRCm39) I94T probably damaging Het
Phykpl T C 11: 51,476,408 (GRCm39) Y43H probably damaging Het
Prag1 T G 8: 36,571,364 (GRCm39) L649R probably damaging Het
Ptgdr2 T C 19: 10,918,361 (GRCm39) F293L probably damaging Het
Rasip1 T G 7: 45,279,704 (GRCm39) S316A possibly damaging Het
Rlf G A 4: 121,004,429 (GRCm39) S1627L probably benign Het
Rtl1 T C 12: 109,557,145 (GRCm39) R1565G probably benign Het
Sart3 G A 5: 113,886,018 (GRCm39) T572M probably damaging Het
Sec24b G T 3: 129,789,573 (GRCm39) S816* probably null Het
Slamf1 C T 1: 171,619,887 (GRCm39) P279L probably benign Het
Slc18a1 C A 8: 69,495,401 (GRCm39) V368F possibly damaging Het
Tuba1c A G 15: 98,935,496 (GRCm39) Y319C probably damaging Het
Unc79 T A 12: 103,036,416 (GRCm39) I579N probably damaging Het
Zbtb22 G T 17: 34,135,956 (GRCm39) V34L probably damaging Het
Other mutations in Tap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
rose APN 17 34,413,914 (GRCm39) missense probably damaging 1.00
IGL01294:Tap1 APN 17 34,413,019 (GRCm39) critical splice donor site probably null
IGL01776:Tap1 APN 17 34,412,102 (GRCm39) missense possibly damaging 0.82
IGL01787:Tap1 APN 17 34,415,578 (GRCm39) missense probably benign 0.21
IGL02246:Tap1 APN 17 34,412,963 (GRCm39) missense probably benign 0.01
IGL02996:Tap1 APN 17 34,410,370 (GRCm39) missense probably damaging 1.00
IGL03278:Tap1 APN 17 34,410,457 (GRCm39) missense probably damaging 1.00
bullus UTSW 17 34,408,536 (GRCm39) critical splice donor site probably null
entertainer UTSW 17 34,412,293 (GRCm39) splice site probably null
joplin UTSW 17 34,412,232 (GRCm39) missense probably damaging 1.00
ragtime UTSW 17 34,409,616 (GRCm39) nonsense probably null
rose2 UTSW 17 34,413,915 (GRCm39) missense probably damaging 1.00
Tapestry UTSW 17 34,412,163 (GRCm39) missense probably damaging 1.00
PIT4802001:Tap1 UTSW 17 34,412,165 (GRCm39) missense probably damaging 1.00
R1566:Tap1 UTSW 17 34,408,520 (GRCm39) missense probably benign 0.00
R1795:Tap1 UTSW 17 34,413,899 (GRCm39) missense probably benign 0.21
R1837:Tap1 UTSW 17 34,407,083 (GRCm39) missense possibly damaging 0.50
R1839:Tap1 UTSW 17 34,407,083 (GRCm39) missense possibly damaging 0.50
R1892:Tap1 UTSW 17 34,413,915 (GRCm39) missense probably damaging 1.00
R1893:Tap1 UTSW 17 34,413,915 (GRCm39) missense probably damaging 1.00
R1952:Tap1 UTSW 17 34,412,481 (GRCm39) missense probably damaging 1.00
R2163:Tap1 UTSW 17 34,408,447 (GRCm39) splice site probably null
R3744:Tap1 UTSW 17 34,412,586 (GRCm39) missense probably damaging 1.00
R3883:Tap1 UTSW 17 34,412,232 (GRCm39) missense probably damaging 1.00
R3975:Tap1 UTSW 17 34,408,541 (GRCm39) unclassified probably benign
R4418:Tap1 UTSW 17 34,407,353 (GRCm39) splice site probably null
R4779:Tap1 UTSW 17 34,412,865 (GRCm39) missense probably damaging 1.00
R4913:Tap1 UTSW 17 34,412,468 (GRCm39) missense possibly damaging 0.94
R5715:Tap1 UTSW 17 34,411,868 (GRCm39) nonsense probably null
R5838:Tap1 UTSW 17 34,412,279 (GRCm39) nonsense probably null
R6248:Tap1 UTSW 17 34,412,151 (GRCm39) missense probably damaging 0.99
R6710:Tap1 UTSW 17 34,407,083 (GRCm39) missense possibly damaging 0.50
R6881:Tap1 UTSW 17 34,407,008 (GRCm39) missense probably damaging 0.99
R7437:Tap1 UTSW 17 34,409,616 (GRCm39) nonsense probably null
R7514:Tap1 UTSW 17 34,415,639 (GRCm39) missense probably damaging 1.00
R7618:Tap1 UTSW 17 34,407,212 (GRCm39) missense possibly damaging 0.94
R7968:Tap1 UTSW 17 34,413,886 (GRCm39) missense probably damaging 0.99
R8115:Tap1 UTSW 17 34,412,293 (GRCm39) splice site probably null
R8322:Tap1 UTSW 17 34,412,163 (GRCm39) missense probably damaging 1.00
R8539:Tap1 UTSW 17 34,408,409 (GRCm39) missense probably benign
R8751:Tap1 UTSW 17 34,412,133 (GRCm39) missense probably benign 0.14
R8883:Tap1 UTSW 17 34,406,867 (GRCm39) missense unknown
R8885:Tap1 UTSW 17 34,408,536 (GRCm39) critical splice donor site probably null
R9191:Tap1 UTSW 17 34,413,956 (GRCm39) critical splice donor site probably null
R9232:Tap1 UTSW 17 34,412,277 (GRCm39) missense probably benign 0.00
R9604:Tap1 UTSW 17 34,412,172 (GRCm39) missense probably damaging 0.99
R9656:Tap1 UTSW 17 34,412,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCCCTTGAGAAGTTTGATG -3'
(R):5'- ACGGGAGGATCAGTTGTCTC -3'

Sequencing Primer
(F):5'- CCCTTGAGAAGTTTGATGTAGCC -3'
(R):5'- TCCTTCCTGAGACAGAGTCCCAG -3'
Posted On 2020-06-30