Incidental Mutation 'R8147:Tnpo3'
ID632850
Institutional Source Beutler Lab
Gene Symbol Tnpo3
Ensembl Gene ENSMUSG00000012535
Gene Nametransportin 3
SynonymsD6Ertd313e, 5730544L10Rik, C430013M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8147 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29540827-29609887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29589214 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 46 (I46V)
Ref Sequence ENSEMBL: ENSMUSP00000012679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]
Predicted Effect probably benign
Transcript: ENSMUST00000012679
AA Change: I46V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: I46V

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115251
AA Change: I46V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: I46V

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170350
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.3%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,742,513 E487G probably damaging Het
Aldh9a1 T A 1: 167,357,380 I287N probably damaging Het
Aox2 T A 1: 58,300,662 N371K probably benign Het
Atr T A 9: 95,899,060 F1392L probably damaging Het
Bicra G A 7: 15,988,470 P374L possibly damaging Het
Cacna1b C T 2: 24,679,176 R912Q probably damaging Het
Cdhr1 T C 14: 37,079,652 N778S probably benign Het
Col4a3bp C T 13: 96,543,228 P22L probably benign Het
Dgat2 C T 7: 99,156,980 V337I possibly damaging Het
Dlg5 T C 14: 24,158,327 D937G probably benign Het
Dqx1 T C 6: 83,060,241 V295A probably benign Het
Dsg3 A G 18: 20,540,073 T934A probably benign Het
Fam81b A C 13: 76,235,021 V243G probably damaging Het
Gen1 A T 12: 11,255,050 probably null Het
Glrx3 G A 7: 137,463,007 S275N probably benign Het
Igdcc4 A T 9: 65,123,971 Q397L probably benign Het
Ints6 C T 14: 62,713,737 G281D probably damaging Het
Kalrn A T 16: 34,055,044 S1722T probably benign Het
Lrrc4b A G 7: 44,462,405 D567G probably damaging Het
Macf1 A G 4: 123,491,698 L1200S probably damaging Het
Mad1l1 G A 5: 140,143,979 R434C probably damaging Het
Mia3 A T 1: 183,328,207 F358I Het
Ncapd3 C T 9: 27,030,718 probably benign Het
Nfkb2 A G 19: 46,307,434 R156G possibly damaging Het
Nus1 T C 10: 52,429,320 probably null Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr1183 T C 2: 88,462,083 F267L possibly damaging Het
Olfr1252 T A 2: 89,721,842 I90F probably damaging Het
Olfr1384 C T 11: 49,514,223 T195I probably benign Het
Pafah1b2 A G 9: 45,983,849 probably null Het
Pold2 T C 11: 5,876,842 T31A probably benign Het
Ppp1r12b T C 1: 134,873,942 N512S possibly damaging Het
Prl8a8 A T 13: 27,511,581 L23Q probably damaging Het
Ptprb T C 10: 116,317,378 V293A probably damaging Het
Rpl18a G T 8: 70,895,425 T174N probably damaging Het
Senp5 A T 16: 31,989,310 H375Q probably benign Het
Setbp1 A T 18: 78,856,800 F1217L probably damaging Het
Skint4 A G 4: 112,136,021 I314V probably benign Het
Slc28a2 A G 2: 122,458,201 D596G probably benign Het
Stat5b A G 11: 100,797,781 I285T probably benign Het
Sycp3 T C 10: 88,462,605 probably null Het
Sympk T C 7: 19,036,793 F270L probably damaging Het
Taar5 T C 10: 23,970,851 V49A probably damaging Het
Tbx18 C T 9: 87,724,358 V245I probably damaging Het
Tet1 A G 10: 62,878,807 M403T probably benign Het
Tmprss11f A T 5: 86,529,910 F333L probably damaging Het
Traf5 G T 1: 192,062,684 N112K probably damaging Het
Trim12c A T 7: 104,341,958 M263K unknown Het
Trim55 A G 3: 19,672,847 I359M probably benign Het
Utp20 A T 10: 88,758,444 W2140R probably benign Het
Vgll3 T C 16: 65,828,078 V104A probably damaging Het
Vmn2r74 C A 7: 85,956,019 G474* probably null Het
Vps18 G A 2: 119,292,756 A98T probably benign Het
Zfand4 T A 6: 116,314,208 S387T probably damaging Het
Zfp808 A G 13: 62,173,120 Y721C probably damaging Het
Other mutations in Tnpo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tnpo3 APN 6 29578461 critical splice donor site probably null
IGL00662:Tnpo3 APN 6 29565846 nonsense probably null
IGL00753:Tnpo3 APN 6 29565787 missense probably benign 0.32
IGL00906:Tnpo3 APN 6 29589048 missense probably damaging 0.99
IGL01311:Tnpo3 APN 6 29586078 missense possibly damaging 0.53
IGL01934:Tnpo3 APN 6 29575020 missense probably benign 0.14
IGL01959:Tnpo3 APN 6 29589020 splice site probably benign
IGL01987:Tnpo3 APN 6 29560201 missense probably benign 0.02
IGL02137:Tnpo3 APN 6 29609451 missense probably damaging 1.00
IGL02645:Tnpo3 APN 6 29562900 nonsense probably null
IGL03409:Tnpo3 APN 6 29555182 missense probably damaging 1.00
PIT4520001:Tnpo3 UTSW 6 29555222 missense possibly damaging 0.60
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0119:Tnpo3 UTSW 6 29568922 missense possibly damaging 0.91
R0143:Tnpo3 UTSW 6 29565652 splice site probably benign
R0384:Tnpo3 UTSW 6 29582164 critical splice donor site probably null
R0597:Tnpo3 UTSW 6 29578565 nonsense probably null
R0710:Tnpo3 UTSW 6 29586075 missense possibly damaging 0.84
R0883:Tnpo3 UTSW 6 29554993 splice site probably benign
R1494:Tnpo3 UTSW 6 29557044 missense probably damaging 1.00
R1529:Tnpo3 UTSW 6 29560221 missense possibly damaging 0.70
R1663:Tnpo3 UTSW 6 29565759 missense probably benign 0.04
R1816:Tnpo3 UTSW 6 29557017 missense probably benign 0.31
R2077:Tnpo3 UTSW 6 29586144 missense possibly damaging 0.94
R2113:Tnpo3 UTSW 6 29551872 missense probably benign 0.07
R2146:Tnpo3 UTSW 6 29589036 missense probably benign 0.18
R2377:Tnpo3 UTSW 6 29579619 missense probably benign 0.19
R3765:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R3766:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R4125:Tnpo3 UTSW 6 29560092 missense probably damaging 1.00
R4525:Tnpo3 UTSW 6 29561398 missense probably benign 0.02
R4786:Tnpo3 UTSW 6 29578542 missense probably benign 0.24
R4830:Tnpo3 UTSW 6 29568938 missense probably benign 0.00
R4948:Tnpo3 UTSW 6 29582260 missense probably benign 0.01
R5215:Tnpo3 UTSW 6 29582153 splice site probably benign
R5325:Tnpo3 UTSW 6 29602013 intron probably benign
R5512:Tnpo3 UTSW 6 29575046 missense probably damaging 1.00
R5619:Tnpo3 UTSW 6 29565198 nonsense probably null
R5689:Tnpo3 UTSW 6 29571064 missense possibly damaging 0.67
R5855:Tnpo3 UTSW 6 29589033 missense probably damaging 1.00
R6101:Tnpo3 UTSW 6 29588043 nonsense probably null
R6105:Tnpo3 UTSW 6 29588043 nonsense probably null
R6137:Tnpo3 UTSW 6 29555268 missense probably benign 0.00
R6481:Tnpo3 UTSW 6 29571101 missense possibly damaging 0.91
R6534:Tnpo3 UTSW 6 29572703 splice site probably null
R6569:Tnpo3 UTSW 6 29571066 missense possibly damaging 0.62
R6976:Tnpo3 UTSW 6 29572595 nonsense probably null
R7006:Tnpo3 UTSW 6 29589163 missense probably damaging 1.00
R7312:Tnpo3 UTSW 6 29562876 missense possibly damaging 0.47
R7365:Tnpo3 UTSW 6 29556996 missense probably damaging 1.00
R7686:Tnpo3 UTSW 6 29562900 nonsense probably null
R7898:Tnpo3 UTSW 6 29565224 missense probably benign 0.01
R7901:Tnpo3 UTSW 6 29568991 missense possibly damaging 0.83
R8003:Tnpo3 UTSW 6 29551901 missense probably benign 0.09
R8144:Tnpo3 UTSW 6 29558762 missense probably benign
R8183:Tnpo3 UTSW 6 29558759 missense probably damaging 0.97
R8297:Tnpo3 UTSW 6 29582303 missense possibly damaging 0.91
R8329:Tnpo3 UTSW 6 29558833 nonsense probably null
R8424:Tnpo3 UTSW 6 29555206 missense probably benign 0.06
Z1088:Tnpo3 UTSW 6 29565843 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTCCGTAATGAGTACAGGC -3'
(R):5'- GTCTTAGGGAATACTGTTGTTGAAC -3'

Sequencing Primer
(F):5'- GTCCGTAATGAGTACAGGCTTTACC -3'
(R):5'- CTGTTGTTGAACATTGAACAGACCC -3'
Posted On2020-06-30