Incidental Mutation 'R8147:Trim12c'
ID632858
Institutional Source Beutler Lab
Gene Symbol Trim12c
Ensembl Gene ENSMUSG00000057143
Gene Nametripartite motif-containing 12C
SynonymsTrim12-2, 9230105E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8147 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104338754-104353362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104341958 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 263 (M263K)
Ref Sequence ENSEMBL: ENSMUSP00000060100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000130139]
Predicted Effect unknown
Transcript: ENSMUST00000059037
AA Change: M263K
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143
AA Change: M263K

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130139
AA Change: M263K
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143
AA Change: M263K

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.3%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,742,513 E487G probably damaging Het
Aldh9a1 T A 1: 167,357,380 I287N probably damaging Het
Aox2 T A 1: 58,300,662 N371K probably benign Het
Atr T A 9: 95,899,060 F1392L probably damaging Het
Bicra G A 7: 15,988,470 P374L possibly damaging Het
Cacna1b C T 2: 24,679,176 R912Q probably damaging Het
Cdhr1 T C 14: 37,079,652 N778S probably benign Het
Col4a3bp C T 13: 96,543,228 P22L probably benign Het
Dgat2 C T 7: 99,156,980 V337I possibly damaging Het
Dlg5 T C 14: 24,158,327 D937G probably benign Het
Dqx1 T C 6: 83,060,241 V295A probably benign Het
Dsg3 A G 18: 20,540,073 T934A probably benign Het
Fam81b A C 13: 76,235,021 V243G probably damaging Het
Gen1 A T 12: 11,255,050 probably null Het
Glrx3 G A 7: 137,463,007 S275N probably benign Het
Igdcc4 A T 9: 65,123,971 Q397L probably benign Het
Ints6 C T 14: 62,713,737 G281D probably damaging Het
Kalrn A T 16: 34,055,044 S1722T probably benign Het
Lrrc4b A G 7: 44,462,405 D567G probably damaging Het
Macf1 A G 4: 123,491,698 L1200S probably damaging Het
Mad1l1 G A 5: 140,143,979 R434C probably damaging Het
Mia3 A T 1: 183,328,207 F358I Het
Ncapd3 C T 9: 27,030,718 probably benign Het
Nfkb2 A G 19: 46,307,434 R156G possibly damaging Het
Nus1 T C 10: 52,429,320 probably null Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr1183 T C 2: 88,462,083 F267L possibly damaging Het
Olfr1252 T A 2: 89,721,842 I90F probably damaging Het
Olfr1384 C T 11: 49,514,223 T195I probably benign Het
Pafah1b2 A G 9: 45,983,849 probably null Het
Pold2 T C 11: 5,876,842 T31A probably benign Het
Ppp1r12b T C 1: 134,873,942 N512S possibly damaging Het
Prl8a8 A T 13: 27,511,581 L23Q probably damaging Het
Ptprb T C 10: 116,317,378 V293A probably damaging Het
Rpl18a G T 8: 70,895,425 T174N probably damaging Het
Senp5 A T 16: 31,989,310 H375Q probably benign Het
Setbp1 A T 18: 78,856,800 F1217L probably damaging Het
Skint4 A G 4: 112,136,021 I314V probably benign Het
Slc28a2 A G 2: 122,458,201 D596G probably benign Het
Stat5b A G 11: 100,797,781 I285T probably benign Het
Sycp3 T C 10: 88,462,605 probably null Het
Sympk T C 7: 19,036,793 F270L probably damaging Het
Taar5 T C 10: 23,970,851 V49A probably damaging Het
Tbx18 C T 9: 87,724,358 V245I probably damaging Het
Tet1 A G 10: 62,878,807 M403T probably benign Het
Tmprss11f A T 5: 86,529,910 F333L probably damaging Het
Tnpo3 T C 6: 29,589,214 I46V probably benign Het
Traf5 G T 1: 192,062,684 N112K probably damaging Het
Trim55 A G 3: 19,672,847 I359M probably benign Het
Utp20 A T 10: 88,758,444 W2140R probably benign Het
Vgll3 T C 16: 65,828,078 V104A probably damaging Het
Vmn2r74 C A 7: 85,956,019 G474* probably null Het
Vps18 G A 2: 119,292,756 A98T probably benign Het
Zfand4 T A 6: 116,314,208 S387T probably damaging Het
Zfp808 A G 13: 62,173,120 Y721C probably damaging Het
Other mutations in Trim12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Trim12c APN 7 104348215 missense possibly damaging 0.81
IGL01645:Trim12c APN 7 104345054 nonsense probably null
IGL01737:Trim12c APN 7 104348062 missense probably damaging 1.00
IGL02184:Trim12c APN 7 104348223 missense probably benign 0.00
IGL02309:Trim12c APN 7 104344956 missense possibly damaging 0.72
IGL02323:Trim12c APN 7 104348266 missense probably benign 0.00
IGL02656:Trim12c APN 7 104341203 missense probably damaging 1.00
R0127:Trim12c UTSW 7 104340906 splice site probably null
R0554:Trim12c UTSW 7 104344962 missense probably damaging 0.96
R1480:Trim12c UTSW 7 104348244 missense probably damaging 1.00
R1501:Trim12c UTSW 7 104340888 unclassified probably benign
R2058:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R2059:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R3838:Trim12c UTSW 7 104340868 unclassified probably benign
R3870:Trim12c UTSW 7 104348337 missense probably benign 0.00
R4896:Trim12c UTSW 7 104340948 missense probably damaging 0.99
R6288:Trim12c UTSW 7 104346729 missense probably benign 0.19
R6522:Trim12c UTSW 7 104348324 missense probably benign 0.38
R6562:Trim12c UTSW 7 104345134 splice site probably null
R6801:Trim12c UTSW 7 104348130 missense probably damaging 1.00
R7016:Trim12c UTSW 7 104348206 missense
R7811:Trim12c UTSW 7 104341262 missense unknown
R8076:Trim12c UTSW 7 104340830 missense unknown
X0062:Trim12c UTSW 7 104346680 missense probably benign 0.13
Z1176:Trim12c UTSW 7 104341136 missense unknown
Predicted Primers PCR Primer
(F):5'- GATGAACAGTCATTTCCCATCTGAG -3'
(R):5'- TGTAAGACCTTCCCAACACTTCG -3'

Sequencing Primer
(F):5'- CTTGAATCCTGCAGCCAA -3'
(R):5'- TCGTTGAATGTAATTTGAAGGAGAC -3'
Posted On2020-06-30