Incidental Mutation 'R8147:Glrx3'
ID632859
Institutional Source Beutler Lab
Gene Symbol Glrx3
Ensembl Gene ENSMUSG00000031068
Gene Nameglutaredoxin 3
SynonymsPKC interacting cousin of thioredoxin, Txnl2, PICOT
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8147 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location137437614-137468594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137463007 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 275 (S275N)
Ref Sequence ENSEMBL: ENSMUSP00000147803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064404] [ENSMUST00000209696] [ENSMUST00000211496] [ENSMUST00000211769]
Predicted Effect probably benign
Transcript: ENSMUST00000064404
AA Change: S275N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066621
Gene: ENSMUSG00000031068
AA Change: S275N

DomainStartEndE-ValueType
Pfam:Phosducin 6 102 6.3e-10 PFAM
Pfam:DIM1 13 112 4.5e-9 PFAM
Pfam:Thioredoxin 15 117 1.2e-21 PFAM
Pfam:Glutaredoxin 148 212 2.9e-19 PFAM
Pfam:Glutaredoxin 250 314 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209696
AA Change: S150N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000211496
AA Change: S275N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000211769
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.3%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality during late organogenesis and early fetal development. Mice heterozygous for this gene trapped allele exhibit increased response to cardiac injury and decreased cardiac muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,742,513 E487G probably damaging Het
Aldh9a1 T A 1: 167,357,380 I287N probably damaging Het
Aox2 T A 1: 58,300,662 N371K probably benign Het
Atr T A 9: 95,899,060 F1392L probably damaging Het
Bicra G A 7: 15,988,470 P374L possibly damaging Het
Cacna1b C T 2: 24,679,176 R912Q probably damaging Het
Cdhr1 T C 14: 37,079,652 N778S probably benign Het
Col4a3bp C T 13: 96,543,228 P22L probably benign Het
Dgat2 C T 7: 99,156,980 V337I possibly damaging Het
Dlg5 T C 14: 24,158,327 D937G probably benign Het
Dqx1 T C 6: 83,060,241 V295A probably benign Het
Dsg3 A G 18: 20,540,073 T934A probably benign Het
Fam81b A C 13: 76,235,021 V243G probably damaging Het
Gen1 A T 12: 11,255,050 probably null Het
Igdcc4 A T 9: 65,123,971 Q397L probably benign Het
Ints6 C T 14: 62,713,737 G281D probably damaging Het
Kalrn A T 16: 34,055,044 S1722T probably benign Het
Lrrc4b A G 7: 44,462,405 D567G probably damaging Het
Macf1 A G 4: 123,491,698 L1200S probably damaging Het
Mad1l1 G A 5: 140,143,979 R434C probably damaging Het
Mia3 A T 1: 183,328,207 F358I Het
Ncapd3 C T 9: 27,030,718 probably benign Het
Nfkb2 A G 19: 46,307,434 R156G possibly damaging Het
Nus1 T C 10: 52,429,320 probably null Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr1183 T C 2: 88,462,083 F267L possibly damaging Het
Olfr1252 T A 2: 89,721,842 I90F probably damaging Het
Olfr1384 C T 11: 49,514,223 T195I probably benign Het
Pafah1b2 A G 9: 45,983,849 probably null Het
Pold2 T C 11: 5,876,842 T31A probably benign Het
Ppp1r12b T C 1: 134,873,942 N512S possibly damaging Het
Prl8a8 A T 13: 27,511,581 L23Q probably damaging Het
Ptprb T C 10: 116,317,378 V293A probably damaging Het
Rpl18a G T 8: 70,895,425 T174N probably damaging Het
Senp5 A T 16: 31,989,310 H375Q probably benign Het
Setbp1 A T 18: 78,856,800 F1217L probably damaging Het
Skint4 A G 4: 112,136,021 I314V probably benign Het
Slc28a2 A G 2: 122,458,201 D596G probably benign Het
Stat5b A G 11: 100,797,781 I285T probably benign Het
Sycp3 T C 10: 88,462,605 probably null Het
Sympk T C 7: 19,036,793 F270L probably damaging Het
Taar5 T C 10: 23,970,851 V49A probably damaging Het
Tbx18 C T 9: 87,724,358 V245I probably damaging Het
Tet1 A G 10: 62,878,807 M403T probably benign Het
Tmprss11f A T 5: 86,529,910 F333L probably damaging Het
Tnpo3 T C 6: 29,589,214 I46V probably benign Het
Traf5 G T 1: 192,062,684 N112K probably damaging Het
Trim12c A T 7: 104,341,958 M263K unknown Het
Trim55 A G 3: 19,672,847 I359M probably benign Het
Utp20 A T 10: 88,758,444 W2140R probably benign Het
Vgll3 T C 16: 65,828,078 V104A probably damaging Het
Vmn2r74 C A 7: 85,956,019 G474* probably null Het
Vps18 G A 2: 119,292,756 A98T probably benign Het
Zfand4 T A 6: 116,314,208 S387T probably damaging Het
Zfp808 A G 13: 62,173,120 Y721C probably damaging Het
Other mutations in Glrx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Glrx3 APN 7 137452713 missense probably damaging 1.00
IGL02435:Glrx3 APN 7 137461396 missense possibly damaging 0.61
F5770:Glrx3 UTSW 7 137459153 missense probably benign
R0347:Glrx3 UTSW 7 137437701 missense unknown
R0359:Glrx3 UTSW 7 137453485 missense possibly damaging 0.80
R1270:Glrx3 UTSW 7 137453414 missense probably benign 0.02
R3692:Glrx3 UTSW 7 137459117 splice site probably benign
R4909:Glrx3 UTSW 7 137445036 missense probably damaging 1.00
R4920:Glrx3 UTSW 7 137464130 missense probably null 1.00
R5509:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R6831:Glrx3 UTSW 7 137459222 missense possibly damaging 0.76
R7200:Glrx3 UTSW 7 137464436 missense possibly damaging 0.81
R7347:Glrx3 UTSW 7 137459286 missense possibly damaging 0.83
R7356:Glrx3 UTSW 7 137452724 missense probably damaging 0.98
R7481:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R7660:Glrx3 UTSW 7 137459225 missense probably damaging 1.00
R7685:Glrx3 UTSW 7 137459191 missense probably damaging 0.98
V7581:Glrx3 UTSW 7 137459153 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGCTGCATGTCACTCAAC -3'
(R):5'- TTTATGCATGGTGAGAACAAGGGC -3'

Sequencing Primer
(F):5'- GCTGCATGTCACTCAACTTAAAAGG -3'
(R):5'- CAAGGGCCAGAAAAGTCCTTTTTG -3'
Posted On2020-06-30