Incidental Mutation 'R8147:Nus1'
ID632867
Institutional Source Beutler Lab
Gene Symbol Nus1
Ensembl Gene ENSMUSG00000023068
Gene NameNUS1 dehydrodolichyl diphosphate synthase subunit
Synonyms1600027K07Rik, D10Ertd438e, NgBR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8147 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location52417547-52440183 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 52429320 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023830] [ENSMUST00000023830] [ENSMUST00000023830]
Predicted Effect probably null
Transcript: ENSMUST00000023830
SMART Domains Protein: ENSMUSP00000023830
Gene: ENSMUSG00000023068

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 63 88 N/A INTRINSIC
Pfam:Prenyltransf 105 296 2.7e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000023830
SMART Domains Protein: ENSMUSP00000023830
Gene: ENSMUSG00000023068

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 63 88 N/A INTRINSIC
Pfam:Prenyltransf 105 296 2.7e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000023830
SMART Domains Protein: ENSMUSP00000023830
Gene: ENSMUSG00000023068

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 63 88 N/A INTRINSIC
Pfam:Prenyltransf 105 296 2.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.3%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to E6.5. MEFs homozygous for a conditionally activated knock-out allele exhibit impaired glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,742,513 E487G probably damaging Het
Aldh9a1 T A 1: 167,357,380 I287N probably damaging Het
Aox2 T A 1: 58,300,662 N371K probably benign Het
Atr T A 9: 95,899,060 F1392L probably damaging Het
Bicra G A 7: 15,988,470 P374L possibly damaging Het
Cacna1b C T 2: 24,679,176 R912Q probably damaging Het
Cdhr1 T C 14: 37,079,652 N778S probably benign Het
Col4a3bp C T 13: 96,543,228 P22L probably benign Het
Dgat2 C T 7: 99,156,980 V337I possibly damaging Het
Dlg5 T C 14: 24,158,327 D937G probably benign Het
Dqx1 T C 6: 83,060,241 V295A probably benign Het
Dsg3 A G 18: 20,540,073 T934A probably benign Het
Fam81b A C 13: 76,235,021 V243G probably damaging Het
Gen1 A T 12: 11,255,050 probably null Het
Glrx3 G A 7: 137,463,007 S275N probably benign Het
Igdcc4 A T 9: 65,123,971 Q397L probably benign Het
Ints6 C T 14: 62,713,737 G281D probably damaging Het
Kalrn A T 16: 34,055,044 S1722T probably benign Het
Lrrc4b A G 7: 44,462,405 D567G probably damaging Het
Macf1 A G 4: 123,491,698 L1200S probably damaging Het
Mad1l1 G A 5: 140,143,979 R434C probably damaging Het
Mia3 A T 1: 183,328,207 F358I Het
Ncapd3 C T 9: 27,030,718 probably benign Het
Nfkb2 A G 19: 46,307,434 R156G possibly damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr1183 T C 2: 88,462,083 F267L possibly damaging Het
Olfr1252 T A 2: 89,721,842 I90F probably damaging Het
Olfr1384 C T 11: 49,514,223 T195I probably benign Het
Pafah1b2 A G 9: 45,983,849 probably null Het
Pold2 T C 11: 5,876,842 T31A probably benign Het
Ppp1r12b T C 1: 134,873,942 N512S possibly damaging Het
Prl8a8 A T 13: 27,511,581 L23Q probably damaging Het
Ptprb T C 10: 116,317,378 V293A probably damaging Het
Rpl18a G T 8: 70,895,425 T174N probably damaging Het
Senp5 A T 16: 31,989,310 H375Q probably benign Het
Setbp1 A T 18: 78,856,800 F1217L probably damaging Het
Skint4 A G 4: 112,136,021 I314V probably benign Het
Slc28a2 A G 2: 122,458,201 D596G probably benign Het
Stat5b A G 11: 100,797,781 I285T probably benign Het
Sycp3 T C 10: 88,462,605 probably null Het
Sympk T C 7: 19,036,793 F270L probably damaging Het
Taar5 T C 10: 23,970,851 V49A probably damaging Het
Tbx18 C T 9: 87,724,358 V245I probably damaging Het
Tet1 A G 10: 62,878,807 M403T probably benign Het
Tmprss11f A T 5: 86,529,910 F333L probably damaging Het
Tnpo3 T C 6: 29,589,214 I46V probably benign Het
Traf5 G T 1: 192,062,684 N112K probably damaging Het
Trim12c A T 7: 104,341,958 M263K unknown Het
Trim55 A G 3: 19,672,847 I359M probably benign Het
Utp20 A T 10: 88,758,444 W2140R probably benign Het
Vgll3 T C 16: 65,828,078 V104A probably damaging Het
Vmn2r74 C A 7: 85,956,019 G474* probably null Het
Vps18 G A 2: 119,292,756 A98T probably benign Het
Zfand4 T A 6: 116,314,208 S387T probably damaging Het
Zfp808 A G 13: 62,173,120 Y721C probably damaging Het
Other mutations in Nus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Nus1 APN 10 52430067 missense probably benign
IGL01983:Nus1 APN 10 52436657 missense probably damaging 0.98
IGL02195:Nus1 APN 10 52433369 missense probably damaging 1.00
R0173:Nus1 UTSW 10 52417998 missense possibly damaging 0.53
R0455:Nus1 UTSW 10 52430094 missense probably damaging 1.00
R5377:Nus1 UTSW 10 52429213 missense possibly damaging 0.73
R5792:Nus1 UTSW 10 52429256 nonsense probably null
R6009:Nus1 UTSW 10 52433443 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGGATCCGTTAGTCATTG -3'
(R):5'- ATTACACATCCCTGGGCTTC -3'

Sequencing Primer
(F):5'- TTGAAGAACATCACTAACCTGGCTG -3'
(R):5'- TGGGCTTCTCTACTCAGGGAC -3'
Posted On2020-06-30