Incidental Mutation 'R8147:Cdhr1'
ID632880
Institutional Source Beutler Lab
Gene Symbol Cdhr1
Ensembl Gene ENSMUSG00000021803
Gene Namecadherin-related family member 1
SynonymsPcdh21, Prcad
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R8147 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location37077857-37098347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37079652 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 778 (N778S)
Ref Sequence ENSEMBL: ENSMUSP00000022337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022337]
Predicted Effect probably benign
Transcript: ENSMUST00000022337
AA Change: N778S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022337
Gene: ENSMUSG00000021803
AA Change: N778S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 57 133 9.4e-7 SMART
CA 157 245 9.44e-21 SMART
CA 269 352 2.06e-12 SMART
CA 383 471 2.68e-11 SMART
CA 495 575 5.26e-19 SMART
CA 594 685 1.64e-6 SMART
transmembrane domain 703 725 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 789 799 N/A INTRINSIC
low complexity region 817 829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.3%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive degeneration of retinal photoreceptor cells and a slight reduction in light responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,742,513 E487G probably damaging Het
Aldh9a1 T A 1: 167,357,380 I287N probably damaging Het
Aox2 T A 1: 58,300,662 N371K probably benign Het
Atr T A 9: 95,899,060 F1392L probably damaging Het
Bicra G A 7: 15,988,470 P374L possibly damaging Het
Cacna1b C T 2: 24,679,176 R912Q probably damaging Het
Col4a3bp C T 13: 96,543,228 P22L probably benign Het
Dgat2 C T 7: 99,156,980 V337I possibly damaging Het
Dlg5 T C 14: 24,158,327 D937G probably benign Het
Dqx1 T C 6: 83,060,241 V295A probably benign Het
Dsg3 A G 18: 20,540,073 T934A probably benign Het
Fam81b A C 13: 76,235,021 V243G probably damaging Het
Gen1 A T 12: 11,255,050 probably null Het
Glrx3 G A 7: 137,463,007 S275N probably benign Het
Igdcc4 A T 9: 65,123,971 Q397L probably benign Het
Ints6 C T 14: 62,713,737 G281D probably damaging Het
Kalrn A T 16: 34,055,044 S1722T probably benign Het
Lrrc4b A G 7: 44,462,405 D567G probably damaging Het
Macf1 A G 4: 123,491,698 L1200S probably damaging Het
Mad1l1 G A 5: 140,143,979 R434C probably damaging Het
Mia3 A T 1: 183,328,207 F358I Het
Ncapd3 C T 9: 27,030,718 probably benign Het
Nfkb2 A G 19: 46,307,434 R156G possibly damaging Het
Nus1 T C 10: 52,429,320 probably null Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr1183 T C 2: 88,462,083 F267L possibly damaging Het
Olfr1252 T A 2: 89,721,842 I90F probably damaging Het
Olfr1384 C T 11: 49,514,223 T195I probably benign Het
Pafah1b2 A G 9: 45,983,849 probably null Het
Pold2 T C 11: 5,876,842 T31A probably benign Het
Ppp1r12b T C 1: 134,873,942 N512S possibly damaging Het
Prl8a8 A T 13: 27,511,581 L23Q probably damaging Het
Ptprb T C 10: 116,317,378 V293A probably damaging Het
Rpl18a G T 8: 70,895,425 T174N probably damaging Het
Senp5 A T 16: 31,989,310 H375Q probably benign Het
Setbp1 A T 18: 78,856,800 F1217L probably damaging Het
Skint4 A G 4: 112,136,021 I314V probably benign Het
Slc28a2 A G 2: 122,458,201 D596G probably benign Het
Stat5b A G 11: 100,797,781 I285T probably benign Het
Sycp3 T C 10: 88,462,605 probably null Het
Sympk T C 7: 19,036,793 F270L probably damaging Het
Taar5 T C 10: 23,970,851 V49A probably damaging Het
Tbx18 C T 9: 87,724,358 V245I probably damaging Het
Tet1 A G 10: 62,878,807 M403T probably benign Het
Tmprss11f A T 5: 86,529,910 F333L probably damaging Het
Tnpo3 T C 6: 29,589,214 I46V probably benign Het
Traf5 G T 1: 192,062,684 N112K probably damaging Het
Trim12c A T 7: 104,341,958 M263K unknown Het
Trim55 A G 3: 19,672,847 I359M probably benign Het
Utp20 A T 10: 88,758,444 W2140R probably benign Het
Vgll3 T C 16: 65,828,078 V104A probably damaging Het
Vmn2r74 C A 7: 85,956,019 G474* probably null Het
Vps18 G A 2: 119,292,756 A98T probably benign Het
Zfand4 T A 6: 116,314,208 S387T probably damaging Het
Zfp808 A G 13: 62,173,120 Y721C probably damaging Het
Other mutations in Cdhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cdhr1 APN 14 37085528 missense probably benign 0.06
IGL01820:Cdhr1 APN 14 37085579 missense probably benign 0.11
IGL02469:Cdhr1 APN 14 37085600 missense possibly damaging 0.68
IGL03373:Cdhr1 APN 14 37096300 missense possibly damaging 0.89
IGL03055:Cdhr1 UTSW 14 37095097 missense probably benign 0.07
PIT4494001:Cdhr1 UTSW 14 37082856 missense probably benign 0.07
R0110:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0219:Cdhr1 UTSW 14 37079601 missense possibly damaging 0.82
R0265:Cdhr1 UTSW 14 37081376 missense probably benign 0.02
R0450:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0510:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0522:Cdhr1 UTSW 14 37094000 critical splice donor site probably null
R0788:Cdhr1 UTSW 14 37087375 critical splice donor site probably null
R0880:Cdhr1 UTSW 14 37080634 missense possibly damaging 0.53
R1209:Cdhr1 UTSW 14 37082942 splice site probably null
R1253:Cdhr1 UTSW 14 37079625 missense probably benign
R1604:Cdhr1 UTSW 14 37095093 missense probably benign 0.29
R1968:Cdhr1 UTSW 14 37079725 missense probably benign 0.00
R2064:Cdhr1 UTSW 14 37095105 missense probably benign 0.10
R2248:Cdhr1 UTSW 14 37081377 missense probably benign
R3843:Cdhr1 UTSW 14 37084927 missense probably benign 0.03
R4178:Cdhr1 UTSW 14 37082939 splice site probably null
R4205:Cdhr1 UTSW 14 37080504 missense probably benign 0.00
R4681:Cdhr1 UTSW 14 37096237 missense probably benign 0.01
R5039:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R5088:Cdhr1 UTSW 14 37089465 missense probably benign 0.08
R5383:Cdhr1 UTSW 14 37089007 missense possibly damaging 0.94
R5507:Cdhr1 UTSW 14 37082845 missense probably damaging 0.98
R5933:Cdhr1 UTSW 14 37089462 missense probably benign 0.01
R6074:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R6291:Cdhr1 UTSW 14 37089465 missense probably benign 0.31
R6449:Cdhr1 UTSW 14 37090597 missense probably benign 0.35
R6890:Cdhr1 UTSW 14 37085645 missense probably damaging 1.00
R6891:Cdhr1 UTSW 14 37097377 splice site probably null
R7653:Cdhr1 UTSW 14 37082201 missense probably benign 0.27
R7740:Cdhr1 UTSW 14 37089380 missense probably damaging 0.98
R7805:Cdhr1 UTSW 14 37081545 missense probably benign 0.00
R8081:Cdhr1 UTSW 14 37094010 missense probably benign 0.01
R8164:Cdhr1 UTSW 14 37079542 missense probably damaging 1.00
R8283:Cdhr1 UTSW 14 37082780 missense probably benign 0.00
R8343:Cdhr1 UTSW 14 37091978 missense probably benign 0.00
X0062:Cdhr1 UTSW 14 37079779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGCTCAGACACCAAAGAAG -3'
(R):5'- TTGTTGTGGCCATAACTGTCC -3'

Sequencing Primer
(F):5'- AAGACTGAACGGGGCCTC -3'
(R):5'- GTGGCCATAACTGTCCTCATC -3'
Posted On2020-06-30