Incidental Mutation 'R8147:Setbp1'
ID632887
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R8147 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78856800 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1217 (F1217L)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect probably damaging
Transcript: ENSMUST00000025430
AA Change: F1217L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: F1217L

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.3%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,742,513 E487G probably damaging Het
Aldh9a1 T A 1: 167,357,380 I287N probably damaging Het
Aox2 T A 1: 58,300,662 N371K probably benign Het
Atr T A 9: 95,899,060 F1392L probably damaging Het
Bicra G A 7: 15,988,470 P374L possibly damaging Het
Cacna1b C T 2: 24,679,176 R912Q probably damaging Het
Cdhr1 T C 14: 37,079,652 N778S probably benign Het
Col4a3bp C T 13: 96,543,228 P22L probably benign Het
Dgat2 C T 7: 99,156,980 V337I possibly damaging Het
Dlg5 T C 14: 24,158,327 D937G probably benign Het
Dqx1 T C 6: 83,060,241 V295A probably benign Het
Dsg3 A G 18: 20,540,073 T934A probably benign Het
Fam81b A C 13: 76,235,021 V243G probably damaging Het
Gen1 A T 12: 11,255,050 probably null Het
Glrx3 G A 7: 137,463,007 S275N probably benign Het
Igdcc4 A T 9: 65,123,971 Q397L probably benign Het
Ints6 C T 14: 62,713,737 G281D probably damaging Het
Kalrn A T 16: 34,055,044 S1722T probably benign Het
Lrrc4b A G 7: 44,462,405 D567G probably damaging Het
Macf1 A G 4: 123,491,698 L1200S probably damaging Het
Mad1l1 G A 5: 140,143,979 R434C probably damaging Het
Mia3 A T 1: 183,328,207 F358I Het
Ncapd3 C T 9: 27,030,718 probably benign Het
Nfkb2 A G 19: 46,307,434 R156G possibly damaging Het
Nus1 T C 10: 52,429,320 probably null Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr1183 T C 2: 88,462,083 F267L possibly damaging Het
Olfr1252 T A 2: 89,721,842 I90F probably damaging Het
Olfr1384 C T 11: 49,514,223 T195I probably benign Het
Pafah1b2 A G 9: 45,983,849 probably null Het
Pold2 T C 11: 5,876,842 T31A probably benign Het
Ppp1r12b T C 1: 134,873,942 N512S possibly damaging Het
Prl8a8 A T 13: 27,511,581 L23Q probably damaging Het
Ptprb T C 10: 116,317,378 V293A probably damaging Het
Rpl18a G T 8: 70,895,425 T174N probably damaging Het
Senp5 A T 16: 31,989,310 H375Q probably benign Het
Skint4 A G 4: 112,136,021 I314V probably benign Het
Slc28a2 A G 2: 122,458,201 D596G probably benign Het
Stat5b A G 11: 100,797,781 I285T probably benign Het
Sycp3 T C 10: 88,462,605 probably null Het
Sympk T C 7: 19,036,793 F270L probably damaging Het
Taar5 T C 10: 23,970,851 V49A probably damaging Het
Tbx18 C T 9: 87,724,358 V245I probably damaging Het
Tet1 A G 10: 62,878,807 M403T probably benign Het
Tmprss11f A T 5: 86,529,910 F333L probably damaging Het
Tnpo3 T C 6: 29,589,214 I46V probably benign Het
Traf5 G T 1: 192,062,684 N112K probably damaging Het
Trim12c A T 7: 104,341,958 M263K unknown Het
Trim55 A G 3: 19,672,847 I359M probably benign Het
Utp20 A T 10: 88,758,444 W2140R probably benign Het
Vgll3 T C 16: 65,828,078 V104A probably damaging Het
Vmn2r74 C A 7: 85,956,019 G474* probably null Het
Vps18 G A 2: 119,292,756 A98T probably benign Het
Zfand4 T A 6: 116,314,208 S387T probably damaging Het
Zfp808 A G 13: 62,173,120 Y721C probably damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 splice site probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
R7840:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7849:Setbp1 UTSW 18 78856853 missense probably benign 0.00
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTACGTCCCAAAGCCTTCAAAG -3'
(R):5'- ACCCATGACAACCTGAGTGG -3'

Sequencing Primer
(F):5'- CGCTGGAAGGATTCATTTCAC -3'
(R):5'- CCTGAGTGGTCTCTTTGCAG -3'
Posted On2020-06-30