Incidental Mutation 'R8147:Setbp1'
ID 632887
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene Name SET binding protein 1
Synonyms Seb
MMRRC Submission 067575-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.596) question?
Stock # R8147 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 78793595-79152606 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78900015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1217 (F1217L)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
AlphaFold Q9Z180
Predicted Effect probably damaging
Transcript: ENSMUST00000025430
AA Change: F1217L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: F1217L

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Meta Mutation Damage Score 0.0734 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.3%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,562,876 (GRCm39) E487G probably damaging Het
Aldh9a1 T A 1: 167,184,949 (GRCm39) I287N probably damaging Het
Aox1 T A 1: 58,339,821 (GRCm39) N371K probably benign Het
Atr T A 9: 95,781,113 (GRCm39) F1392L probably damaging Het
Bicra G A 7: 15,722,395 (GRCm39) P374L possibly damaging Het
Cacna1b C T 2: 24,569,188 (GRCm39) R912Q probably damaging Het
Cdhr1 T C 14: 36,801,609 (GRCm39) N778S probably benign Het
Cert1 C T 13: 96,679,736 (GRCm39) P22L probably benign Het
Dgat2 C T 7: 98,806,187 (GRCm39) V337I possibly damaging Het
Dlg5 T C 14: 24,208,395 (GRCm39) D937G probably benign Het
Dqx1 T C 6: 83,037,222 (GRCm39) V295A probably benign Het
Dsg3 A G 18: 20,673,130 (GRCm39) T934A probably benign Het
Fam81b A C 13: 76,383,140 (GRCm39) V243G probably damaging Het
Gen1 A T 12: 11,305,051 (GRCm39) probably null Het
Glrx3 G A 7: 137,064,736 (GRCm39) S275N probably benign Het
Igdcc4 A T 9: 65,031,253 (GRCm39) Q397L probably benign Het
Ints6 C T 14: 62,951,186 (GRCm39) G281D probably damaging Het
Kalrn A T 16: 33,875,414 (GRCm39) S1722T probably benign Het
Lrrc4b A G 7: 44,111,829 (GRCm39) D567G probably damaging Het
Macf1 A G 4: 123,385,491 (GRCm39) L1200S probably damaging Het
Mad1l1 G A 5: 140,129,734 (GRCm39) R434C probably damaging Het
Mia3 A T 1: 183,109,062 (GRCm39) F358I Het
Ncapd3 C T 9: 26,942,014 (GRCm39) probably benign Het
Nfkb2 A G 19: 46,295,873 (GRCm39) R156G possibly damaging Het
Nus1 T C 10: 52,305,416 (GRCm39) probably null Het
Or2y14 C T 11: 49,405,050 (GRCm39) T195I probably benign Het
Or4a79 T A 2: 89,552,186 (GRCm39) I90F probably damaging Het
Or4c31 T C 2: 88,292,427 (GRCm39) F267L possibly damaging Het
Or5aq1b T A 2: 86,902,017 (GRCm39) I154F probably benign Het
Pafah1b2 A G 9: 45,895,147 (GRCm39) probably null Het
Pold2 T C 11: 5,826,842 (GRCm39) T31A probably benign Het
Ppp1r12b T C 1: 134,801,680 (GRCm39) N512S possibly damaging Het
Prl8a8 A T 13: 27,695,564 (GRCm39) L23Q probably damaging Het
Ptprb T C 10: 116,153,283 (GRCm39) V293A probably damaging Het
Rpl18a G T 8: 71,348,069 (GRCm39) T174N probably damaging Het
Senp5 A T 16: 31,808,128 (GRCm39) H375Q probably benign Het
Skint4 A G 4: 111,993,218 (GRCm39) I314V probably benign Het
Slc28a2 A G 2: 122,288,682 (GRCm39) D596G probably benign Het
Stat5b A G 11: 100,688,607 (GRCm39) I285T probably benign Het
Sycp3 T C 10: 88,298,467 (GRCm39) probably null Het
Sympk T C 7: 18,770,718 (GRCm39) F270L probably damaging Het
Taar5 T C 10: 23,846,749 (GRCm39) V49A probably damaging Het
Tbx18 C T 9: 87,606,411 (GRCm39) V245I probably damaging Het
Tet1 A G 10: 62,714,586 (GRCm39) M403T probably benign Het
Tmprss11f A T 5: 86,677,769 (GRCm39) F333L probably damaging Het
Tnpo3 T C 6: 29,589,213 (GRCm39) I46V probably benign Het
Traf5 G T 1: 191,746,984 (GRCm39) N112K probably damaging Het
Trim12c A T 7: 103,991,165 (GRCm39) M263K unknown Het
Trim55 A G 3: 19,727,011 (GRCm39) I359M probably benign Het
Utp20 A T 10: 88,594,306 (GRCm39) W2140R probably benign Het
Vgll3 T C 16: 65,624,964 (GRCm39) V104A probably damaging Het
Vmn2r74 C A 7: 85,605,227 (GRCm39) G474* probably null Het
Vps18 G A 2: 119,123,237 (GRCm39) A98T probably benign Het
Zfand4 T A 6: 116,291,169 (GRCm39) S387T probably damaging Het
Zfp808 A G 13: 62,320,934 (GRCm39) Y721C probably damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78,798,894 (GRCm39) nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78,900,985 (GRCm39) missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78,899,992 (GRCm39) missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78,900,625 (GRCm39) missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78,900,514 (GRCm39) missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78,900,688 (GRCm39) missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78,798,925 (GRCm39) missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78,900,589 (GRCm39) nonsense probably null
IGL03005:Setbp1 APN 18 78,902,340 (GRCm39) missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78,900,224 (GRCm39) missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78,900,841 (GRCm39) missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78,901,075 (GRCm39) missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78,900,451 (GRCm39) missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78,899,798 (GRCm39) missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78,901,423 (GRCm39) missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78,826,573 (GRCm39) missense probably benign 0.00
R1481:Setbp1 UTSW 18 78,826,516 (GRCm39) missense probably benign 0.01
R1482:Setbp1 UTSW 18 79,130,050 (GRCm39) missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78,903,127 (GRCm39) missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78,901,807 (GRCm39) missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78,901,682 (GRCm39) missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78,900,613 (GRCm39) missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78,901,577 (GRCm39) missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78,901,759 (GRCm39) missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78,899,935 (GRCm39) missense probably benign 0.00
R2851:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2853:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2941:Setbp1 UTSW 18 78,901,412 (GRCm39) missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78,900,650 (GRCm39) missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78,902,518 (GRCm39) missense probably benign 0.00
R3807:Setbp1 UTSW 18 78,826,537 (GRCm39) missense probably benign 0.01
R4133:Setbp1 UTSW 18 78,900,206 (GRCm39) missense probably benign 0.05
R4287:Setbp1 UTSW 18 78,902,276 (GRCm39) missense probably benign 0.03
R4345:Setbp1 UTSW 18 79,129,794 (GRCm39) missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78,899,833 (GRCm39) missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79,129,896 (GRCm39) missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79,130,164 (GRCm39) missense probably benign 0.00
R4595:Setbp1 UTSW 18 78,900,731 (GRCm39) missense probably benign 0.00
R4817:Setbp1 UTSW 18 78,902,015 (GRCm39) missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78,901,382 (GRCm39) missense probably benign 0.07
R4976:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78,899,809 (GRCm39) missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78,900,514 (GRCm39) missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78,900,697 (GRCm39) missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78,901,214 (GRCm39) missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78,900,190 (GRCm39) missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78,901,278 (GRCm39) missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79,129,867 (GRCm39) missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78,900,700 (GRCm39) missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78,899,860 (GRCm39) missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78,899,697 (GRCm39) splice site probably null
R5940:Setbp1 UTSW 18 78,798,703 (GRCm39) missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78,902,455 (GRCm39) missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6250:Setbp1 UTSW 18 78,901,217 (GRCm39) missense probably benign 0.00
R6256:Setbp1 UTSW 18 78,900,472 (GRCm39) missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78,826,584 (GRCm39) missense probably benign 0.21
R6522:Setbp1 UTSW 18 78,900,605 (GRCm39) missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78,902,774 (GRCm39) missense probably benign 0.00
R6886:Setbp1 UTSW 18 78,900,715 (GRCm39) missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78,901,054 (GRCm39) missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79,130,070 (GRCm39) missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79,130,175 (GRCm39) missense probably benign 0.08
R7134:Setbp1 UTSW 18 78,902,734 (GRCm39) missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78,900,052 (GRCm39) missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78,798,960 (GRCm39) missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78,900,701 (GRCm39) missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.06
R7589:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.01
R7840:Setbp1 UTSW 18 78,826,639 (GRCm39) missense probably benign 0.03
R7849:Setbp1 UTSW 18 78,900,068 (GRCm39) missense probably benign 0.00
R8354:Setbp1 UTSW 18 78,900,598 (GRCm39) missense probably damaging 1.00
R8446:Setbp1 UTSW 18 78,900,971 (GRCm39) missense probably damaging 1.00
R8524:Setbp1 UTSW 18 78,901,969 (GRCm39) missense probably damaging 1.00
R8534:Setbp1 UTSW 18 78,826,542 (GRCm39) missense possibly damaging 0.86
R8694:Setbp1 UTSW 18 78,901,516 (GRCm39) missense probably damaging 1.00
R8931:Setbp1 UTSW 18 78,899,723 (GRCm39) missense probably benign 0.00
R8983:Setbp1 UTSW 18 78,902,459 (GRCm39) missense probably benign 0.37
R9062:Setbp1 UTSW 18 78,900,266 (GRCm39) missense probably benign 0.01
R9113:Setbp1 UTSW 18 78,900,948 (GRCm39) missense probably damaging 0.99
R9364:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9513:Setbp1 UTSW 18 78,899,781 (GRCm39) missense probably damaging 1.00
R9517:Setbp1 UTSW 18 78,901,322 (GRCm39) missense probably damaging 0.99
R9549:Setbp1 UTSW 18 78,902,629 (GRCm39) missense probably benign 0.07
R9554:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9680:Setbp1 UTSW 18 78,902,498 (GRCm39) missense probably benign
R9711:Setbp1 UTSW 18 78,900,142 (GRCm39) missense probably benign 0.30
Z1088:Setbp1 UTSW 18 78,902,809 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTACGTCCCAAAGCCTTCAAAG -3'
(R):5'- ACCCATGACAACCTGAGTGG -3'

Sequencing Primer
(F):5'- CGCTGGAAGGATTCATTTCAC -3'
(R):5'- CCTGAGTGGTCTCTTTGCAG -3'
Posted On 2020-06-30