Incidental Mutation 'R0102:Pon2'
ID63289
Institutional Source Beutler Lab
Gene Symbol Pon2
Ensembl Gene ENSMUSG00000032667
Gene Nameparaoxonase 2
Synonyms
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0102 (G1)
Quality Score144
Status Validated
Chromosome6
Chromosomal Location5264147-5298455 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 5289091 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057792]
Predicted Effect probably benign
Transcript: ENSMUST00000057792
SMART Domains Protein: ENSMUSP00000062670
Gene: ENSMUSG00000032667

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:SGL 107 303 1e-12 PFAM
Pfam:Arylesterase 167 252 3.9e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135342
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed an atherogenic diet, mice homozygous for a gene trapped allele show markedly lower VLDL/LDL cholesterol and serum apoB levels, higher cellular oxidative stress, enhanced macrophage immunoreactivity and LDL-induced monocyte chemotaxis, and largeratheromatous lesions than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Pon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Pon2 APN 6 5272331 missense probably damaging 1.00
IGL02683:Pon2 APN 6 5269062 missense probably damaging 1.00
IGL03240:Pon2 APN 6 5265316 utr 3 prime probably benign
R0102:Pon2 UTSW 6 5289091 splice site probably benign
R0360:Pon2 UTSW 6 5266156 nonsense probably null
R0364:Pon2 UTSW 6 5266156 nonsense probably null
R0402:Pon2 UTSW 6 5272410 nonsense probably null
R0494:Pon2 UTSW 6 5267059 splice site probably benign
R1593:Pon2 UTSW 6 5273003 missense probably benign
R3001:Pon2 UTSW 6 5268976 critical splice donor site probably null
R3002:Pon2 UTSW 6 5268976 critical splice donor site probably null
R3236:Pon2 UTSW 6 5266986 missense possibly damaging 0.59
R4467:Pon2 UTSW 6 5267021 missense probably benign 0.24
R4911:Pon2 UTSW 6 5269029 missense possibly damaging 0.93
R5237:Pon2 UTSW 6 5265455 missense probably benign
R6025:Pon2 UTSW 6 5289057 missense probably benign 0.40
R6313:Pon2 UTSW 6 5272421 missense probably damaging 1.00
R6737:Pon2 UTSW 6 5266183 missense probably benign 0.04
R7427:Pon2 UTSW 6 5268995 missense probably damaging 0.99
R7438:Pon2 UTSW 6 5289080 missense probably benign
R7517:Pon2 UTSW 6 5268997 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACAGACTGCCGGGACCATGTAAAG -3'
(R):5'- AGGTGCTGAGTTATCTAGGCCCAG -3'

Sequencing Primer
(F):5'- CGGGACCATGTAAAGTTTCAAC -3'
(R):5'- GAGTTATCTAGGCCCAGCCATC -3'
Posted On2013-07-30