Incidental Mutation 'R8150:Slc19a3'
ID632890
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R8150 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83022495 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 267 (Y267S)
Ref Sequence ENSEMBL: ENSMUSP00000041683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect probably damaging
Transcript: ENSMUST00000045560
AA Change: Y267S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: Y267S

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164473
AA Change: Y267S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: Y267S

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,533,824 M129L probably benign Het
Abca2 T C 2: 25,447,381 I2416T probably damaging Het
Abca3 A G 17: 24,396,548 D871G probably benign Het
Akap9 C T 5: 3,961,982 T895I probably damaging Het
Aldh8a1 A G 10: 21,395,545 E390G probably damaging Het
Ank2 T A 3: 126,947,513 D1574V Het
Blmh T C 11: 76,968,629 V352A probably benign Het
C130079G13Rik A G 3: 59,936,137 D84G probably damaging Het
Cacna1i T C 15: 80,375,339 L1270P probably damaging Het
Ccdc80 T A 16: 45,127,429 H923Q probably damaging Het
Cdc27 G A 11: 104,515,460 H610Y probably damaging Het
Cep126 T C 9: 8,101,790 I248V probably benign Het
Ces5a T C 8: 93,530,802 N125S probably damaging Het
Chd3 G A 11: 69,363,684 H201Y probably benign Het
Cpeb1 T C 7: 81,357,404 T292A probably damaging Het
Gli2 G A 1: 118,835,828 T1531I probably damaging Het
Gm6871 T C 7: 41,547,761 T7A Het
Kank1 A G 19: 25,410,799 D612G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Mfsd6 T A 1: 52,708,641 D355V probably benign Het
Myo7a T C 7: 98,063,639 K1710E probably benign Het
Olfr270 C G 4: 52,970,788 H56D probably damaging Het
Olfr608 A G 7: 103,470,252 D71G probably damaging Het
Pcdha8 G A 18: 36,993,211 V249M probably damaging Het
Pglyrp3 A G 3: 92,026,483 D145G probably benign Het
Pkhd1l1 A G 15: 44,546,659 K2521E possibly damaging Het
Pld3 A G 7: 27,532,661 V398A probably damaging Het
Plxnb1 A T 9: 109,112,078 T1642S probably damaging Het
Ppp2r1a T G 17: 20,959,438 V348G possibly damaging Het
Prdm2 C A 4: 143,132,733 C1329F possibly damaging Het
Ric8a G T 7: 140,861,356 G423V probably damaging Het
Rnf17 A G 14: 56,421,136 D94G probably benign Het
Serpina3f T C 12: 104,219,510 F325L probably damaging Het
Sin3a T A 9: 57,127,284 V1247E possibly damaging Het
Skint5 C A 4: 113,940,890 M165I probably benign Het
Slc22a27 A T 19: 7,910,025 F196Y possibly damaging Het
Slc5a4b A T 10: 76,103,846 I152N possibly damaging Het
Tbc1d9 T A 8: 83,255,890 V768E probably damaging Het
Tex15 T A 8: 33,573,506 M988K probably benign Het
Top2b T A 14: 16,393,291 F317I probably damaging Het
Wfdc8 A T 2: 164,597,535 L309* probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp949 C T 9: 88,570,000 T541I probably benign Het
Zkscan16 T A 4: 58,952,407 I235N probably benign Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
tag UTSW 1 83026260 missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83022748 missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 83019441 missense probably benign 0.02
R8412:Slc19a3 UTSW 1 83014812 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTACACTTACCTCCAAATGTTGC -3'
(R):5'- TCTACCAATGCCTAAGAAGAGC -3'

Sequencing Primer
(F):5'- AAATGTTGCTATGGCCTCTACTG -3'
(R):5'- GTCCGATAGAGACGATTGTCC -3'
Posted On2020-06-30