Incidental Mutation 'R8150:Akap9'
ID 632904
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene Name A kinase anchor protein 9
Synonyms mei2-5, repro12, AKAP450, G1-448-15, 5730481H23Rik
MMRRC Submission 067576-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R8150 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 3977410-4130204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4011982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 895 (T895I)
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044492
AA Change: T895I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: T895I

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143365
SMART Domains Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Blast:HPT 144 215 9e-22 BLAST
low complexity region 255 267 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
coiled coil region 422 571 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,538,635 (GRCm39) M129L probably benign Het
Aadacl2fm1 A G 3: 59,843,558 (GRCm39) D84G probably damaging Het
Abca2 T C 2: 25,337,393 (GRCm39) I2416T probably damaging Het
Abca3 A G 17: 24,615,522 (GRCm39) D871G probably benign Het
Aldh8a1 A G 10: 21,271,444 (GRCm39) E390G probably damaging Het
Ank2 T A 3: 126,741,162 (GRCm39) D1574V Het
Blmh T C 11: 76,859,455 (GRCm39) V352A probably benign Het
Cacna1i T C 15: 80,259,540 (GRCm39) L1270P probably damaging Het
Ccdc80 T A 16: 44,947,792 (GRCm39) H923Q probably damaging Het
Cdc27 G A 11: 104,406,286 (GRCm39) H610Y probably damaging Het
Cep126 T C 9: 8,101,791 (GRCm39) I248V probably benign Het
Ces5a T C 8: 94,257,430 (GRCm39) N125S probably damaging Het
Chd3 G A 11: 69,254,510 (GRCm39) H201Y probably benign Het
Cpeb1 T C 7: 81,007,152 (GRCm39) T292A probably damaging Het
Gli2 G A 1: 118,763,558 (GRCm39) T1531I probably damaging Het
Gm6871 T C 7: 41,197,185 (GRCm39) T7A Het
Kank1 A G 19: 25,388,163 (GRCm39) D612G possibly damaging Het
Lhcgr AT ATT 17: 89,049,677 (GRCm39) 615 probably null Het
Mfsd6 T A 1: 52,747,800 (GRCm39) D355V probably benign Het
Myo7a T C 7: 97,712,846 (GRCm39) K1710E probably benign Het
Or13d1 C G 4: 52,970,788 (GRCm39) H56D probably damaging Het
Or52ae7 A G 7: 103,119,459 (GRCm39) D71G probably damaging Het
Pcdha8 G A 18: 37,126,264 (GRCm39) V249M probably damaging Het
Pglyrp3 A G 3: 91,933,790 (GRCm39) D145G probably benign Het
Pkhd1l1 A G 15: 44,410,055 (GRCm39) K2521E possibly damaging Het
Pld3 A G 7: 27,232,086 (GRCm39) V398A probably damaging Het
Plxnb1 A T 9: 108,941,146 (GRCm39) T1642S probably damaging Het
Ppp2r1a T G 17: 21,179,700 (GRCm39) V348G possibly damaging Het
Prdm2 C A 4: 142,859,303 (GRCm39) C1329F possibly damaging Het
Ric8a G T 7: 140,441,269 (GRCm39) G423V probably damaging Het
Rnf17 A G 14: 56,658,593 (GRCm39) D94G probably benign Het
Serpina3f T C 12: 104,185,769 (GRCm39) F325L probably damaging Het
Sin3a T A 9: 57,034,568 (GRCm39) V1247E possibly damaging Het
Skint5 C A 4: 113,798,087 (GRCm39) M165I probably benign Het
Slc19a3 T G 1: 83,000,216 (GRCm39) Y267S probably damaging Het
Slc22a27 A T 19: 7,887,390 (GRCm39) F196Y possibly damaging Het
Slc5a4b A T 10: 75,939,680 (GRCm39) I152N possibly damaging Het
Tbc1d9 T A 8: 83,982,519 (GRCm39) V768E probably damaging Het
Tex15 T A 8: 34,063,534 (GRCm39) M988K probably benign Het
Top2b T A 14: 16,393,291 (GRCm38) F317I probably damaging Het
Wfdc8 A T 2: 164,439,455 (GRCm39) L309* probably null Het
Wipf1 G A 2: 73,267,879 (GRCm39) P173L possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp949 C T 9: 88,452,053 (GRCm39) T541I probably benign Het
Zkscan16 T A 4: 58,952,407 (GRCm39) I235N probably benign Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4,096,639 (GRCm39) missense probably damaging 0.97
IGL00642:Akap9 APN 5 4,010,842 (GRCm39) missense probably damaging 0.99
IGL00786:Akap9 APN 5 4,120,522 (GRCm39) missense probably damaging 1.00
IGL00788:Akap9 APN 5 4,110,480 (GRCm39) missense probably damaging 1.00
IGL00969:Akap9 APN 5 4,051,550 (GRCm39) missense probably benign
IGL01014:Akap9 APN 5 4,018,683 (GRCm39) missense probably benign 0.41
IGL01302:Akap9 APN 5 4,020,711 (GRCm39) missense probably benign 0.27
IGL01610:Akap9 APN 5 4,082,839 (GRCm39) missense possibly damaging 0.95
IGL01620:Akap9 APN 5 4,010,218 (GRCm39) missense probably benign 0.11
IGL01862:Akap9 APN 5 4,115,856 (GRCm39) missense probably damaging 0.99
IGL01862:Akap9 APN 5 4,001,705 (GRCm39) missense probably damaging 0.99
IGL02151:Akap9 APN 5 4,082,728 (GRCm39) nonsense probably null
IGL02635:Akap9 APN 5 4,120,500 (GRCm39) missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4,119,130 (GRCm39) missense possibly damaging 0.88
IGL02967:Akap9 APN 5 4,026,164 (GRCm39) missense probably benign 0.07
IGL03064:Akap9 APN 5 4,018,755 (GRCm39) missense probably damaging 1.00
IGL03289:Akap9 APN 5 4,127,261 (GRCm39) missense probably damaging 1.00
Andy UTSW 5 4,011,764 (GRCm39) nonsense probably null
blimey UTSW 5 4,120,397 (GRCm39) nonsense probably null
hoarder UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
marinarum UTSW 5 4,063,875 (GRCm39) nonsense probably null
miser UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
naviculus UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
thrifty UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
wee_one UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
FR4449:Akap9 UTSW 5 4,031,214 (GRCm39) unclassified probably benign
PIT1430001:Akap9 UTSW 5 4,079,849 (GRCm39) missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4,096,221 (GRCm39) missense probably benign 0.24
R0088:Akap9 UTSW 5 4,011,946 (GRCm39) missense probably benign 0.22
R0309:Akap9 UTSW 5 4,119,038 (GRCm39) missense probably benign 0.01
R0387:Akap9 UTSW 5 4,001,678 (GRCm39) splice site probably benign
R0440:Akap9 UTSW 5 4,114,569 (GRCm39) missense probably damaging 0.99
R0441:Akap9 UTSW 5 4,011,714 (GRCm39) missense probably benign 0.15
R0491:Akap9 UTSW 5 4,022,851 (GRCm39) unclassified probably benign
R0501:Akap9 UTSW 5 4,020,685 (GRCm39) missense probably damaging 1.00
R0507:Akap9 UTSW 5 4,119,043 (GRCm39) missense probably benign 0.41
R0544:Akap9 UTSW 5 4,119,185 (GRCm39) missense probably benign 0.22
R0581:Akap9 UTSW 5 4,100,620 (GRCm39) missense probably benign 0.03
R0611:Akap9 UTSW 5 4,004,870 (GRCm39) missense probably benign 0.00
R0620:Akap9 UTSW 5 4,114,136 (GRCm39) missense probably damaging 0.98
R0639:Akap9 UTSW 5 4,110,318 (GRCm39) missense probably damaging 1.00
R0932:Akap9 UTSW 5 4,096,492 (GRCm39) missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4,114,742 (GRCm39) splice site probably null
R1101:Akap9 UTSW 5 4,096,205 (GRCm39) missense probably benign 0.00
R1159:Akap9 UTSW 5 4,010,865 (GRCm39) missense probably damaging 0.98
R1170:Akap9 UTSW 5 4,105,671 (GRCm39) missense probably benign
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1185:Akap9 UTSW 5 3,998,783 (GRCm39) missense probably benign 0.13
R1453:Akap9 UTSW 5 4,025,614 (GRCm39) splice site probably null
R1551:Akap9 UTSW 5 4,119,174 (GRCm39) missense probably benign 0.02
R1608:Akap9 UTSW 5 4,011,783 (GRCm39) missense probably damaging 1.00
R1652:Akap9 UTSW 5 4,127,210 (GRCm39) missense probably damaging 1.00
R1659:Akap9 UTSW 5 4,114,633 (GRCm39) missense probably damaging 1.00
R1713:Akap9 UTSW 5 4,089,345 (GRCm39) critical splice donor site probably null
R1719:Akap9 UTSW 5 4,007,645 (GRCm39) nonsense probably null
R1720:Akap9 UTSW 5 4,022,791 (GRCm39) missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4,051,667 (GRCm39) missense probably benign 0.41
R1872:Akap9 UTSW 5 4,051,406 (GRCm39) missense probably damaging 1.00
R1876:Akap9 UTSW 5 4,011,809 (GRCm39) missense probably benign 0.28
R1881:Akap9 UTSW 5 4,100,173 (GRCm39) missense probably benign
R1950:Akap9 UTSW 5 4,010,677 (GRCm39) missense probably damaging 1.00
R1980:Akap9 UTSW 5 4,022,771 (GRCm39) missense probably damaging 0.99
R1993:Akap9 UTSW 5 4,088,520 (GRCm39) splice site probably null
R2008:Akap9 UTSW 5 4,010,131 (GRCm39) missense possibly damaging 0.47
R2020:Akap9 UTSW 5 4,011,967 (GRCm39) missense probably damaging 1.00
R2051:Akap9 UTSW 5 4,025,685 (GRCm39) nonsense probably null
R2061:Akap9 UTSW 5 4,011,010 (GRCm39) missense probably damaging 1.00
R2109:Akap9 UTSW 5 4,094,847 (GRCm39) missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4,114,509 (GRCm39) missense probably damaging 1.00
R2225:Akap9 UTSW 5 4,127,271 (GRCm39) missense probably damaging 0.96
R2232:Akap9 UTSW 5 4,096,603 (GRCm39) missense probably damaging 1.00
R2424:Akap9 UTSW 5 4,115,279 (GRCm39) missense probably damaging 0.97
R2483:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R2879:Akap9 UTSW 5 4,026,353 (GRCm39) intron probably benign
R3622:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3623:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3624:Akap9 UTSW 5 4,026,235 (GRCm39) missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4,120,351 (GRCm39) missense probably damaging 1.00
R3806:Akap9 UTSW 5 4,004,410 (GRCm39) missense probably benign 0.00
R3919:Akap9 UTSW 5 4,011,764 (GRCm39) nonsense probably null
R4023:Akap9 UTSW 5 4,042,077 (GRCm39) missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4,093,996 (GRCm39) missense probably damaging 0.99
R4434:Akap9 UTSW 5 4,082,708 (GRCm39) missense probably damaging 0.99
R4529:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4530:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4532:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4533:Akap9 UTSW 5 4,093,948 (GRCm39) missense probably damaging 1.00
R4585:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4586:Akap9 UTSW 5 4,026,151 (GRCm39) missense probably benign 0.00
R4655:Akap9 UTSW 5 4,096,403 (GRCm39) missense probably benign 0.14
R4676:Akap9 UTSW 5 4,114,515 (GRCm39) nonsense probably null
R4676:Akap9 UTSW 5 4,082,774 (GRCm39) missense probably damaging 1.00
R4724:Akap9 UTSW 5 4,105,339 (GRCm39) missense probably benign
R4731:Akap9 UTSW 5 4,012,266 (GRCm39) missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4733:Akap9 UTSW 5 4,063,901 (GRCm39) missense probably damaging 0.98
R4743:Akap9 UTSW 5 4,011,013 (GRCm39) missense probably damaging 1.00
R4749:Akap9 UTSW 5 4,018,737 (GRCm39) missense probably benign 0.41
R4756:Akap9 UTSW 5 4,051,418 (GRCm39) missense probably damaging 0.99
R4757:Akap9 UTSW 5 4,058,382 (GRCm39) missense probably damaging 1.00
R4860:Akap9 UTSW 5 4,084,916 (GRCm39) intron probably benign
R4937:Akap9 UTSW 5 4,100,145 (GRCm39) splice site probably null
R4960:Akap9 UTSW 5 4,007,664 (GRCm39) missense probably benign 0.15
R4974:Akap9 UTSW 5 4,011,466 (GRCm39) missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4,051,748 (GRCm39) missense probably damaging 0.96
R5160:Akap9 UTSW 5 4,080,007 (GRCm39) missense probably damaging 1.00
R5200:Akap9 UTSW 5 4,010,734 (GRCm39) missense probably benign 0.00
R5245:Akap9 UTSW 5 4,026,209 (GRCm39) missense probably damaging 0.99
R5293:Akap9 UTSW 5 3,998,687 (GRCm39) missense probably damaging 0.99
R5408:Akap9 UTSW 5 4,108,458 (GRCm39) missense possibly damaging 0.84
R5507:Akap9 UTSW 5 4,018,683 (GRCm39) missense probably benign 0.41
R5517:Akap9 UTSW 5 4,051,665 (GRCm39) missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4,114,714 (GRCm39) missense possibly damaging 0.93
R5619:Akap9 UTSW 5 4,004,760 (GRCm39) intron probably benign
R5645:Akap9 UTSW 5 4,100,590 (GRCm39) missense probably benign 0.09
R5669:Akap9 UTSW 5 4,100,540 (GRCm39) nonsense probably null
R5686:Akap9 UTSW 5 4,021,926 (GRCm39) missense probably benign 0.00
R5697:Akap9 UTSW 5 4,010,170 (GRCm39) missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4,096,064 (GRCm39) missense probably benign 0.13
R5875:Akap9 UTSW 5 4,127,285 (GRCm39) missense probably benign 0.01
R5897:Akap9 UTSW 5 4,127,904 (GRCm39) missense probably benign 0.23
R5999:Akap9 UTSW 5 4,093,925 (GRCm39) missense probably damaging 1.00
R6025:Akap9 UTSW 5 4,082,801 (GRCm39) missense probably damaging 1.00
R6078:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6138:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
R6225:Akap9 UTSW 5 4,012,105 (GRCm39) missense probably damaging 1.00
R6243:Akap9 UTSW 5 4,115,000 (GRCm39) splice site probably null
R6326:Akap9 UTSW 5 4,012,061 (GRCm39) missense probably damaging 1.00
R6564:Akap9 UTSW 5 4,078,491 (GRCm39) missense probably damaging 0.98
R6617:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6625:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R6632:Akap9 UTSW 5 4,063,842 (GRCm39) splice site probably null
R6677:Akap9 UTSW 5 4,079,869 (GRCm39) missense probably benign 0.21
R6717:Akap9 UTSW 5 4,114,086 (GRCm39) missense probably damaging 1.00
R6893:Akap9 UTSW 5 4,011,709 (GRCm39) missense probably benign 0.32
R6915:Akap9 UTSW 5 4,010,551 (GRCm39) missense probably benign 0.03
R6938:Akap9 UTSW 5 4,096,628 (GRCm39) missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4,096,699 (GRCm39) missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4,115,866 (GRCm39) missense possibly damaging 0.65
R7032:Akap9 UTSW 5 4,004,896 (GRCm39) missense probably benign
R7164:Akap9 UTSW 5 4,110,364 (GRCm39) missense probably damaging 0.96
R7170:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7192:Akap9 UTSW 5 4,055,723 (GRCm39) splice site probably null
R7284:Akap9 UTSW 5 4,006,246 (GRCm39) missense probably damaging 1.00
R7299:Akap9 UTSW 5 4,082,696 (GRCm39) missense probably damaging 1.00
R7313:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7326:Akap9 UTSW 5 4,095,930 (GRCm39) missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4,096,364 (GRCm39) missense probably damaging 0.99
R7455:Akap9 UTSW 5 4,022,792 (GRCm39) missense probably benign 0.03
R7482:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7489:Akap9 UTSW 5 4,054,933 (GRCm39) missense probably damaging 1.00
R7525:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7528:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7576:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7577:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7578:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7610:Akap9 UTSW 5 4,007,677 (GRCm39) missense possibly damaging 0.95
R7658:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R7754:Akap9 UTSW 5 4,096,736 (GRCm39) missense probably benign 0.03
R7818:Akap9 UTSW 5 4,063,875 (GRCm39) nonsense probably null
R7979:Akap9 UTSW 5 4,100,381 (GRCm39) missense probably benign
R7991:Akap9 UTSW 5 4,114,949 (GRCm39) splice site probably null
R8036:Akap9 UTSW 5 4,120,397 (GRCm39) nonsense probably null
R8054:Akap9 UTSW 5 4,088,707 (GRCm39) critical splice donor site probably null
R8116:Akap9 UTSW 5 4,111,183 (GRCm39) missense probably benign 0.04
R8234:Akap9 UTSW 5 4,094,845 (GRCm39) missense probably benign 0.18
R8348:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8365:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8366:Akap9 UTSW 5 4,018,745 (GRCm39) missense probably benign 0.04
R8448:Akap9 UTSW 5 3,998,897 (GRCm39) critical splice donor site probably null
R8466:Akap9 UTSW 5 4,088,659 (GRCm39) missense probably damaging 1.00
R8772:Akap9 UTSW 5 4,096,255 (GRCm39) missense probably damaging 1.00
R8881:Akap9 UTSW 5 4,011,279 (GRCm39) missense
R8937:Akap9 UTSW 5 4,094,048 (GRCm39) missense possibly damaging 0.78
R8956:Akap9 UTSW 5 3,998,805 (GRCm39) missense possibly damaging 0.79
R9000:Akap9 UTSW 5 4,105,650 (GRCm39) missense probably benign
R9049:Akap9 UTSW 5 4,114,597 (GRCm39) missense
R9074:Akap9 UTSW 5 4,127,959 (GRCm39) missense probably benign 0.40
R9124:Akap9 UTSW 5 4,111,284 (GRCm39) missense probably damaging 0.99
R9129:Akap9 UTSW 5 4,119,089 (GRCm39) missense probably benign 0.00
R9371:Akap9 UTSW 5 4,011,852 (GRCm39) missense possibly damaging 0.83
R9424:Akap9 UTSW 5 4,012,224 (GRCm39) nonsense probably null
R9424:Akap9 UTSW 5 4,012,223 (GRCm39) nonsense probably null
R9509:Akap9 UTSW 5 4,096,349 (GRCm39) missense probably benign
R9515:Akap9 UTSW 5 4,105,709 (GRCm39) missense probably damaging 1.00
R9567:Akap9 UTSW 5 4,127,311 (GRCm39) missense possibly damaging 0.89
R9587:Akap9 UTSW 5 4,119,149 (GRCm39) missense probably damaging 1.00
R9619:Akap9 UTSW 5 4,094,833 (GRCm39) missense probably damaging 1.00
R9635:Akap9 UTSW 5 4,100,545 (GRCm39) missense probably benign 0.20
R9680:Akap9 UTSW 5 4,011,587 (GRCm39) missense probably benign 0.03
R9691:Akap9 UTSW 5 4,010,491 (GRCm39) missense probably damaging 1.00
R9726:Akap9 UTSW 5 4,053,757 (GRCm39) missense probably benign 0.39
U15987:Akap9 UTSW 5 4,117,924 (GRCm39) critical splice donor site probably null
X0026:Akap9 UTSW 5 4,064,039 (GRCm39) missense probably damaging 1.00
X0057:Akap9 UTSW 5 4,025,598 (GRCm39) critical splice acceptor site probably null
Z1176:Akap9 UTSW 5 4,012,251 (GRCm39) missense probably damaging 0.96
Z1177:Akap9 UTSW 5 4,096,189 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGGGAGTATACTTGTCTGC -3'
(R):5'- GTTAGCGAGGAGTTCAAGTTCTC -3'

Sequencing Primer
(F):5'- AGAGGGAGTATACTTGTCTGCTCAAG -3'
(R):5'- GTTCTCCACATCTCAATAAAAGCTG -3'
Posted On 2020-06-30