Incidental Mutation 'R8150:Ric8a'
ID632910
Institutional Source Beutler Lab
Gene Symbol Ric8a
Ensembl Gene ENSMUSG00000025485
Gene NameRIC8 guanine nucleotide exchange factor A
Synonymssynembryn, RIC-8, Ric8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8150 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140856957-140864372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 140861356 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 423 (G423V)
Ref Sequence ENSEMBL: ENSMUSP00000026558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026557] [ENSMUST00000026558] [ENSMUST00000026559] [ENSMUST00000106048] [ENSMUST00000137024] [ENSMUST00000209766] [ENSMUST00000210296] [ENSMUST00000210708] [ENSMUST00000210710] [ENSMUST00000211179] [ENSMUST00000211624]
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000026558
AA Change: G423V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026558
Gene: ENSMUSG00000025485
AA Change: G423V

DomainStartEndE-ValueType
Pfam:Ric8 66 505 2.3e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026559
SMART Domains Protein: ENSMUSP00000026559
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 5.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106048
SMART Domains Protein: ENSMUSP00000101663
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 184 8.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137024
SMART Domains Protein: ENSMUSP00000114247
Gene: ENSMUSG00000025486

DomainStartEndE-ValueType
Pfam:SIR2 3 178 1.7e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209766
AA Change: G188V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000210296
Predicted Effect probably benign
Transcript: ENSMUST00000210708
Predicted Effect probably benign
Transcript: ENSMUST00000210710
Predicted Effect probably benign
Transcript: ENSMUST00000211179
Predicted Effect probably benign
Transcript: ENSMUST00000211624
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality during gastrulation. Heterozygotes exhibit impaired spatial learning and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,533,824 M129L probably benign Het
Abca2 T C 2: 25,447,381 I2416T probably damaging Het
Abca3 A G 17: 24,396,548 D871G probably benign Het
Akap9 C T 5: 3,961,982 T895I probably damaging Het
Aldh8a1 A G 10: 21,395,545 E390G probably damaging Het
Ank2 T A 3: 126,947,513 D1574V Het
Blmh T C 11: 76,968,629 V352A probably benign Het
C130079G13Rik A G 3: 59,936,137 D84G probably damaging Het
Cacna1i T C 15: 80,375,339 L1270P probably damaging Het
Ccdc80 T A 16: 45,127,429 H923Q probably damaging Het
Cdc27 G A 11: 104,515,460 H610Y probably damaging Het
Cep126 T C 9: 8,101,790 I248V probably benign Het
Ces5a T C 8: 93,530,802 N125S probably damaging Het
Chd3 G A 11: 69,363,684 H201Y probably benign Het
Cpeb1 T C 7: 81,357,404 T292A probably damaging Het
Gli2 G A 1: 118,835,828 T1531I probably damaging Het
Gm6871 T C 7: 41,547,761 T7A Het
Kank1 A G 19: 25,410,799 D612G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Mfsd6 T A 1: 52,708,641 D355V probably benign Het
Myo7a T C 7: 98,063,639 K1710E probably benign Het
Olfr270 C G 4: 52,970,788 H56D probably damaging Het
Olfr608 A G 7: 103,470,252 D71G probably damaging Het
Pcdha8 G A 18: 36,993,211 V249M probably damaging Het
Pglyrp3 A G 3: 92,026,483 D145G probably benign Het
Pkhd1l1 A G 15: 44,546,659 K2521E possibly damaging Het
Pld3 A G 7: 27,532,661 V398A probably damaging Het
Plxnb1 A T 9: 109,112,078 T1642S probably damaging Het
Ppp2r1a T G 17: 20,959,438 V348G possibly damaging Het
Prdm2 C A 4: 143,132,733 C1329F possibly damaging Het
Rnf17 A G 14: 56,421,136 D94G probably benign Het
Serpina3f T C 12: 104,219,510 F325L probably damaging Het
Sin3a T A 9: 57,127,284 V1247E possibly damaging Het
Skint5 C A 4: 113,940,890 M165I probably benign Het
Slc19a3 T G 1: 83,022,495 Y267S probably damaging Het
Slc22a27 A T 19: 7,910,025 F196Y possibly damaging Het
Slc5a4b A T 10: 76,103,846 I152N possibly damaging Het
Tbc1d9 T A 8: 83,255,890 V768E probably damaging Het
Tex15 T A 8: 33,573,506 M988K probably benign Het
Top2b T A 14: 16,393,291 F317I probably damaging Het
Wfdc8 A T 2: 164,597,535 L309* probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp949 C T 9: 88,570,000 T541I probably benign Het
Zkscan16 T A 4: 58,952,407 I235N probably benign Het
Other mutations in Ric8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Ric8a APN 7 140862357 missense probably benign 0.00
R0277:Ric8a UTSW 7 140857900 unclassified probably benign
R0529:Ric8a UTSW 7 140860893 missense probably damaging 1.00
R0707:Ric8a UTSW 7 140857973 unclassified probably benign
R1272:Ric8a UTSW 7 140862376 missense probably benign 0.22
R1627:Ric8a UTSW 7 140858178 missense probably damaging 0.98
R1655:Ric8a UTSW 7 140860895 missense probably benign 0.01
R2281:Ric8a UTSW 7 140861938 missense probably benign 0.44
R2327:Ric8a UTSW 7 140859558 missense probably damaging 1.00
R3721:Ric8a UTSW 7 140861961 critical splice donor site probably null
R4287:Ric8a UTSW 7 140861422 missense probably damaging 1.00
R4504:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4505:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4506:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4507:Ric8a UTSW 7 140858516 missense probably benign 0.03
R4552:Ric8a UTSW 7 140861337 missense probably damaging 1.00
R5500:Ric8a UTSW 7 140858315 missense probably benign 0.43
R6737:Ric8a UTSW 7 140858876 splice site probably null
R8391:Ric8a UTSW 7 140858003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAAGCTTGTCCGCCTCATG -3'
(R):5'- GTCCTATGTACTACTGGTTCGAGC -3'

Sequencing Primer
(F):5'- AGAGTAGCTGCCGAGTTCCTC -3'
(R):5'- ACTACTGGTTCGAGCTGGAGAG -3'
Posted On2020-06-30