Incidental Mutation 'R8150:Cep126'
ID632914
Institutional Source Beutler Lab
Gene Symbol Cep126
Ensembl Gene ENSMUSG00000040729
Gene Namecentrosomal protein 126
SynonymsAK129341
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8150 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location8076461-8134294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8101790 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 248 (I248V)
Ref Sequence ENSEMBL: ENSMUSP00000042904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037397]
Predicted Effect probably benign
Transcript: ENSMUST00000037397
AA Change: I248V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042904
Gene: ENSMUSG00000040729
AA Change: I248V

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:K1377 100 1061 N/A PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,533,824 M129L probably benign Het
Abca2 T C 2: 25,447,381 I2416T probably damaging Het
Abca3 A G 17: 24,396,548 D871G probably benign Het
Akap9 C T 5: 3,961,982 T895I probably damaging Het
Aldh8a1 A G 10: 21,395,545 E390G probably damaging Het
Ank2 T A 3: 126,947,513 D1574V Het
Blmh T C 11: 76,968,629 V352A probably benign Het
C130079G13Rik A G 3: 59,936,137 D84G probably damaging Het
Cacna1i T C 15: 80,375,339 L1270P probably damaging Het
Ccdc80 T A 16: 45,127,429 H923Q probably damaging Het
Cdc27 G A 11: 104,515,460 H610Y probably damaging Het
Ces5a T C 8: 93,530,802 N125S probably damaging Het
Chd3 G A 11: 69,363,684 H201Y probably benign Het
Cpeb1 T C 7: 81,357,404 T292A probably damaging Het
Gli2 G A 1: 118,835,828 T1531I probably damaging Het
Gm6871 T C 7: 41,547,761 T7A Het
Kank1 A G 19: 25,410,799 D612G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Mfsd6 T A 1: 52,708,641 D355V probably benign Het
Myo7a T C 7: 98,063,639 K1710E probably benign Het
Olfr270 C G 4: 52,970,788 H56D probably damaging Het
Olfr608 A G 7: 103,470,252 D71G probably damaging Het
Pcdha8 G A 18: 36,993,211 V249M probably damaging Het
Pglyrp3 A G 3: 92,026,483 D145G probably benign Het
Pkhd1l1 A G 15: 44,546,659 K2521E possibly damaging Het
Pld3 A G 7: 27,532,661 V398A probably damaging Het
Plxnb1 A T 9: 109,112,078 T1642S probably damaging Het
Ppp2r1a T G 17: 20,959,438 V348G possibly damaging Het
Prdm2 C A 4: 143,132,733 C1329F possibly damaging Het
Ric8a G T 7: 140,861,356 G423V probably damaging Het
Rnf17 A G 14: 56,421,136 D94G probably benign Het
Serpina3f T C 12: 104,219,510 F325L probably damaging Het
Sin3a T A 9: 57,127,284 V1247E possibly damaging Het
Skint5 C A 4: 113,940,890 M165I probably benign Het
Slc19a3 T G 1: 83,022,495 Y267S probably damaging Het
Slc22a27 A T 19: 7,910,025 F196Y possibly damaging Het
Slc5a4b A T 10: 76,103,846 I152N possibly damaging Het
Tbc1d9 T A 8: 83,255,890 V768E probably damaging Het
Tex15 T A 8: 33,573,506 M988K probably benign Het
Top2b T A 14: 16,393,291 F317I probably damaging Het
Wfdc8 A T 2: 164,597,535 L309* probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp949 C T 9: 88,570,000 T541I probably benign Het
Zkscan16 T A 4: 58,952,407 I235N probably benign Het
Other mutations in Cep126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Cep126 APN 9 8103319 missense possibly damaging 0.57
IGL01967:Cep126 APN 9 8095208 splice site probably null
IGL02065:Cep126 APN 9 8099924 missense probably benign 0.09
IGL03215:Cep126 APN 9 8100530 nonsense probably null
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0184:Cep126 UTSW 9 8103395 missense probably benign 0.19
R0835:Cep126 UTSW 9 8130223 missense probably damaging 1.00
R0980:Cep126 UTSW 9 8100719 missense probably damaging 0.99
R1288:Cep126 UTSW 9 8112181 missense probably benign 0.01
R1341:Cep126 UTSW 9 8099776 missense possibly damaging 0.78
R1351:Cep126 UTSW 9 8100086 missense probably damaging 0.99
R1484:Cep126 UTSW 9 8100553 missense possibly damaging 0.81
R1707:Cep126 UTSW 9 8100382 missense probably benign 0.00
R1732:Cep126 UTSW 9 8099761 missense probably benign
R1903:Cep126 UTSW 9 8120747 missense possibly damaging 0.58
R1968:Cep126 UTSW 9 8100908 missense probably damaging 1.00
R2216:Cep126 UTSW 9 8120678 missense probably damaging 1.00
R2260:Cep126 UTSW 9 8101748 missense possibly damaging 0.50
R2444:Cep126 UTSW 9 8101306 missense probably damaging 1.00
R4208:Cep126 UTSW 9 8100821 missense probably damaging 1.00
R4499:Cep126 UTSW 9 8101588 missense possibly damaging 0.80
R4585:Cep126 UTSW 9 8103337 missense probably damaging 0.99
R5547:Cep126 UTSW 9 8100427 missense probably damaging 0.97
R5752:Cep126 UTSW 9 8120745 nonsense probably null
R5794:Cep126 UTSW 9 8103439 missense possibly damaging 0.64
R5932:Cep126 UTSW 9 8103508 missense probably damaging 1.00
R5956:Cep126 UTSW 9 8112119 missense probably benign 0.08
R6354:Cep126 UTSW 9 8099927 missense probably damaging 1.00
R6442:Cep126 UTSW 9 8100563 missense probably benign 0.14
R6964:Cep126 UTSW 9 8112100 missense probably null 0.99
R7134:Cep126 UTSW 9 8103382 missense probably damaging 1.00
R7161:Cep126 UTSW 9 8087399 missense probably benign 0.02
R7221:Cep126 UTSW 9 8100987 nonsense probably null
R7338:Cep126 UTSW 9 8099798 missense possibly damaging 0.50
R7345:Cep126 UTSW 9 8099816 missense probably damaging 1.00
R7473:Cep126 UTSW 9 8101778 missense probably damaging 1.00
R7860:Cep126 UTSW 9 8120748 missense probably damaging 1.00
R7974:Cep126 UTSW 9 8120763 missense probably benign 0.37
R8204:Cep126 UTSW 9 8120780 missense probably damaging 1.00
X0060:Cep126 UTSW 9 8087255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCTGACTATTTTGAGCATC -3'
(R):5'- CATGGGGTGTGCTACAAAGGTG -3'

Sequencing Primer
(F):5'- TTGAGCATCTAAGTTTGTAAGCC -3'
(R):5'- ATTTGCTGTGTCAAGGAGG -3'
Posted On2020-06-30