Incidental Mutation 'R8150:Zfp949'
ID632916
Institutional Source Beutler Lab
Gene Symbol Zfp949
Ensembl Gene ENSMUSG00000032425
Gene Namezinc finger protein 949
Synonyms4930422I07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8150 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location88548020-88571061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88570000 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 541 (T541I)
Ref Sequence ENSEMBL: ENSMUSP00000125017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160652] [ENSMUST00000161458] [ENSMUST00000162827]
Predicted Effect probably benign
Transcript: ENSMUST00000160652
Predicted Effect probably benign
Transcript: ENSMUST00000161458
AA Change: T541I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125017
Gene: ENSMUSG00000032425
AA Change: T541I

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162827
AA Change: T541I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125325
Gene: ENSMUSG00000032425
AA Change: T541I

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis with defects in growth, development, cell proliferation, apoptosis and turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,533,824 M129L probably benign Het
Abca2 T C 2: 25,447,381 I2416T probably damaging Het
Abca3 A G 17: 24,396,548 D871G probably benign Het
Akap9 C T 5: 3,961,982 T895I probably damaging Het
Aldh8a1 A G 10: 21,395,545 E390G probably damaging Het
Ank2 T A 3: 126,947,513 D1574V Het
Blmh T C 11: 76,968,629 V352A probably benign Het
C130079G13Rik A G 3: 59,936,137 D84G probably damaging Het
Cacna1i T C 15: 80,375,339 L1270P probably damaging Het
Ccdc80 T A 16: 45,127,429 H923Q probably damaging Het
Cdc27 G A 11: 104,515,460 H610Y probably damaging Het
Cep126 T C 9: 8,101,790 I248V probably benign Het
Ces5a T C 8: 93,530,802 N125S probably damaging Het
Chd3 G A 11: 69,363,684 H201Y probably benign Het
Cpeb1 T C 7: 81,357,404 T292A probably damaging Het
Gli2 G A 1: 118,835,828 T1531I probably damaging Het
Gm6871 T C 7: 41,547,761 T7A Het
Kank1 A G 19: 25,410,799 D612G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Mfsd6 T A 1: 52,708,641 D355V probably benign Het
Myo7a T C 7: 98,063,639 K1710E probably benign Het
Olfr270 C G 4: 52,970,788 H56D probably damaging Het
Olfr608 A G 7: 103,470,252 D71G probably damaging Het
Pcdha8 G A 18: 36,993,211 V249M probably damaging Het
Pglyrp3 A G 3: 92,026,483 D145G probably benign Het
Pkhd1l1 A G 15: 44,546,659 K2521E possibly damaging Het
Pld3 A G 7: 27,532,661 V398A probably damaging Het
Plxnb1 A T 9: 109,112,078 T1642S probably damaging Het
Ppp2r1a T G 17: 20,959,438 V348G possibly damaging Het
Prdm2 C A 4: 143,132,733 C1329F possibly damaging Het
Ric8a G T 7: 140,861,356 G423V probably damaging Het
Rnf17 A G 14: 56,421,136 D94G probably benign Het
Serpina3f T C 12: 104,219,510 F325L probably damaging Het
Sin3a T A 9: 57,127,284 V1247E possibly damaging Het
Skint5 C A 4: 113,940,890 M165I probably benign Het
Slc19a3 T G 1: 83,022,495 Y267S probably damaging Het
Slc22a27 A T 19: 7,910,025 F196Y possibly damaging Het
Slc5a4b A T 10: 76,103,846 I152N possibly damaging Het
Tbc1d9 T A 8: 83,255,890 V768E probably damaging Het
Tex15 T A 8: 33,573,506 M988K probably benign Het
Top2b T A 14: 16,393,291 F317I probably damaging Het
Wfdc8 A T 2: 164,597,535 L309* probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zkscan16 T A 4: 58,952,407 I235N probably benign Het
Other mutations in Zfp949
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03201:Zfp949 APN 9 88568664 missense probably benign 0.23
R0034:Zfp949 UTSW 9 88567640 intron probably benign
R0462:Zfp949 UTSW 9 88568734 missense possibly damaging 0.63
R1457:Zfp949 UTSW 9 88569838 missense probably damaging 1.00
R1574:Zfp949 UTSW 9 88569777 nonsense probably null
R1574:Zfp949 UTSW 9 88569777 nonsense probably null
R1878:Zfp949 UTSW 9 88569303 missense probably damaging 0.99
R1917:Zfp949 UTSW 9 88570062 missense probably damaging 0.98
R4488:Zfp949 UTSW 9 88570089 missense probably damaging 0.98
R4839:Zfp949 UTSW 9 88569994 missense probably damaging 0.97
R5309:Zfp949 UTSW 9 88567183 missense possibly damaging 0.92
R5312:Zfp949 UTSW 9 88567183 missense possibly damaging 0.92
R5461:Zfp949 UTSW 9 88569484 missense probably benign 0.00
R6530:Zfp949 UTSW 9 88567287 critical splice donor site probably null
R6844:Zfp949 UTSW 9 88569411 missense possibly damaging 0.91
R7749:Zfp949 UTSW 9 88569870 missense probably damaging 1.00
R7937:Zfp949 UTSW 9 88569270 missense probably damaging 1.00
R8290:Zfp949 UTSW 9 88569240 missense probably damaging 0.98
R8349:Zfp949 UTSW 9 88567249 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACCTTTCCCAGTGAATTAGACATTA -3'
(R):5'- GAGTTCTCTGATGCCGGCT -3'

Sequencing Primer
(F):5'- AAGCCCTATGCATGCAGTG -3'
(R):5'- ATGCCGGCTTAGGTTTGAC -3'
Posted On2020-06-30