Mutagenetix > Incidental Mutation

Incidental Mutation 'R8150:Chd3'

632920

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1

MMRRC Submission

067576-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8150 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69234099-69260232 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 69254510 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 201 (H201Y)

Ref Sequence

ENSEMBL: ENSMUSP00000104301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]

AlphaFold

B1AR17

Predicted Effect

probably benign
Transcript: ENSMUST00000092971
AA Change: H201Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: H201Y

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108661
AA Change: H201Y

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: H201Y

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: H107Y

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144701

SMART Domains

Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	23	32	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
PHD	84	127	1.54e-14	SMART
RING	85	126	4.25e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154046

SMART Domains

Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
low complexity region	1	29	N/A	INTRINSIC
low complexity region	50	66	N/A	INTRINSIC
PHD	86	129	1.54e-14	SMART
RING	87	128	4.25e-1	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 98.5%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	T	A	2: 19,538,635 (GRCm39)	M129L	probably benign	Het
Aadacl2fm1	A	G	3: 59,843,558 (GRCm39)	D84G	probably damaging	Het
Abca2	T	C	2: 25,337,393 (GRCm39)	I2416T	probably damaging	Het
Abca3	A	G	17: 24,615,522 (GRCm39)	D871G	probably benign	Het
Akap9	C	T	5: 4,011,982 (GRCm39)	T895I	probably damaging	Het
Aldh8a1	A	G	10: 21,271,444 (GRCm39)	E390G	probably damaging	Het
Ank2	T	A	3: 126,741,162 (GRCm39)	D1574V		Het
Blmh	T	C	11: 76,859,455 (GRCm39)	V352A	probably benign	Het
Cacna1i	T	C	15: 80,259,540 (GRCm39)	L1270P	probably damaging	Het
Ccdc80	T	A	16: 44,947,792 (GRCm39)	H923Q	probably damaging	Het
Cdc27	G	A	11: 104,406,286 (GRCm39)	H610Y	probably damaging	Het
Cep126	T	C	9: 8,101,791 (GRCm39)	I248V	probably benign	Het
Ces5a	T	C	8: 94,257,430 (GRCm39)	N125S	probably damaging	Het
Cpeb1	T	C	7: 81,007,152 (GRCm39)	T292A	probably damaging	Het
Gli2	G	A	1: 118,763,558 (GRCm39)	T1531I	probably damaging	Het
Gm6871	T	C	7: 41,197,185 (GRCm39)	T7A		Het
Kank1	A	G	19: 25,388,163 (GRCm39)	D612G	possibly damaging	Het
Lhcgr	AT	ATT	17: 89,049,677 (GRCm39)	615	probably null	Het
Mfsd6	T	A	1: 52,747,800 (GRCm39)	D355V	probably benign	Het
Myo7a	T	C	7: 97,712,846 (GRCm39)	K1710E	probably benign	Het
Or13d1	C	G	4: 52,970,788 (GRCm39)	H56D	probably damaging	Het
Or52ae7	A	G	7: 103,119,459 (GRCm39)	D71G	probably damaging	Het
Pcdha8	G	A	18: 37,126,264 (GRCm39)	V249M	probably damaging	Het
Pglyrp3	A	G	3: 91,933,790 (GRCm39)	D145G	probably benign	Het
Pkhd1l1	A	G	15: 44,410,055 (GRCm39)	K2521E	possibly damaging	Het
Pld3	A	G	7: 27,232,086 (GRCm39)	V398A	probably damaging	Het
Plxnb1	A	T	9: 108,941,146 (GRCm39)	T1642S	probably damaging	Het
Ppp2r1a	T	G	17: 21,179,700 (GRCm39)	V348G	possibly damaging	Het
Prdm2	C	A	4: 142,859,303 (GRCm39)	C1329F	possibly damaging	Het
Ric8a	G	T	7: 140,441,269 (GRCm39)	G423V	probably damaging	Het
Rnf17	A	G	14: 56,658,593 (GRCm39)	D94G	probably benign	Het
Serpina3f	T	C	12: 104,185,769 (GRCm39)	F325L	probably damaging	Het
Sin3a	T	A	9: 57,034,568 (GRCm39)	V1247E	possibly damaging	Het
Skint5	C	A	4: 113,798,087 (GRCm39)	M165I	probably benign	Het
Slc19a3	T	G	1: 83,000,216 (GRCm39)	Y267S	probably damaging	Het
Slc22a27	A	T	19: 7,887,390 (GRCm39)	F196Y	possibly damaging	Het
Slc5a4b	A	T	10: 75,939,680 (GRCm39)	I152N	possibly damaging	Het
Tbc1d9	T	A	8: 83,982,519 (GRCm39)	V768E	probably damaging	Het
Tex15	T	A	8: 34,063,534 (GRCm39)	M988K	probably benign	Het
Top2b	T	A	14: 16,393,291 (GRCm38)	F317I	probably damaging	Het
Wfdc8	A	T	2: 164,439,455 (GRCm39)	L309*	probably null	Het
Wipf1	G	A	2: 73,267,879 (GRCm39)	P173L	possibly damaging	Het
Zfp217	G	A	2: 169,961,571 (GRCm39)	S252F	possibly damaging	Het
Zfp949	C	T	9: 88,452,053 (GRCm39)	T541I	probably benign	Het
Zkscan16	T	A	4: 58,952,407 (GRCm39)	I235N	probably benign	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69,247,888 (GRCm39)	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69,237,455 (GRCm39)	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69,248,209 (GRCm39)	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69,240,697 (GRCm39)	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69,250,791 (GRCm39)	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69,248,557 (GRCm39)	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69,244,037 (GRCm39)	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69,250,806 (GRCm39)	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69,239,568 (GRCm39)	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69,249,060 (GRCm39)	unclassified	probably benign
IGL01635:Chd3	APN	11	69,252,076 (GRCm39)	splice site	probably benign
IGL01942:Chd3	APN	11	69,240,931 (GRCm39)	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69,248,319 (GRCm39)	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69,251,501 (GRCm39)	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69,251,886 (GRCm39)	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69,250,655 (GRCm39)	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69,242,920 (GRCm39)	unclassified	probably benign
IGL02415:Chd3	APN	11	69,239,739 (GRCm39)	splice site	probably benign
IGL02648:Chd3	APN	11	69,242,976 (GRCm39)	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69,251,874 (GRCm39)	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69,245,230 (GRCm39)	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69,252,022 (GRCm39)	nonsense	probably null
IGL03168:Chd3	APN	11	69,239,741 (GRCm39)	splice site	probably benign
IGL03327:Chd3	APN	11	69,241,012 (GRCm39)	missense	probably damaging	1.00
burg	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
castello	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
feste	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
Fortress	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
moat	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
Redoubt	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
schloss	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
siege	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69,240,732 (GRCm39)	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69,250,739 (GRCm39)	unclassified	probably benign
R0129:Chd3	UTSW	11	69,239,327 (GRCm39)	nonsense	probably null
R0130:Chd3	UTSW	11	69,250,656 (GRCm39)	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69,247,844 (GRCm39)	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69,247,159 (GRCm39)	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69,248,367 (GRCm39)	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69,244,931 (GRCm39)	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69,252,495 (GRCm39)	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69,235,184 (GRCm39)	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69,236,313 (GRCm39)	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69,238,021 (GRCm39)	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69,248,400 (GRCm39)	splice site	probably null
R1484:Chd3	UTSW	11	69,250,725 (GRCm39)	missense	probably benign	0.17
R1741:Chd3	UTSW	11	69,246,480 (GRCm39)	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69,255,523 (GRCm39)	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69,244,727 (GRCm39)	unclassified	probably benign
R1833:Chd3	UTSW	11	69,244,949 (GRCm39)	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69,239,878 (GRCm39)	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69,239,877 (GRCm39)	missense	probably benign
R2147:Chd3	UTSW	11	69,239,854 (GRCm39)	missense	probably benign	0.00
R2513:Chd3	UTSW	11	69,251,471 (GRCm39)	missense	probably damaging	1.00
R2877:Chd3	UTSW	11	69,251,998 (GRCm39)	nonsense	probably null
R2879:Chd3	UTSW	11	69,254,924 (GRCm39)	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69,242,946 (GRCm39)	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69,251,442 (GRCm39)	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69,252,973 (GRCm39)	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69,254,876 (GRCm39)	nonsense	probably null
R3845:Chd3	UTSW	11	69,237,585 (GRCm39)	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69,250,011 (GRCm39)	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69,239,827 (GRCm39)	missense	probably benign
R4115:Chd3	UTSW	11	69,248,343 (GRCm39)	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69,240,703 (GRCm39)	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69,244,035 (GRCm39)	nonsense	probably null
R4622:Chd3	UTSW	11	69,239,834 (GRCm39)	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4635:Chd3	UTSW	11	69,253,013 (GRCm39)	unclassified	probably benign
R4859:Chd3	UTSW	11	69,250,722 (GRCm39)	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69,245,034 (GRCm39)	unclassified	probably benign
R5173:Chd3	UTSW	11	69,260,069 (GRCm39)	unclassified	probably benign
R5287:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5403:Chd3	UTSW	11	69,239,895 (GRCm39)	splice site	probably null
R5511:Chd3	UTSW	11	69,252,301 (GRCm39)	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69,244,177 (GRCm39)	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69,252,261 (GRCm39)	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69,242,944 (GRCm39)	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69,240,063 (GRCm39)	missense	probably benign
R6211:Chd3	UTSW	11	69,243,503 (GRCm39)	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69,247,380 (GRCm39)	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69,236,361 (GRCm39)	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69,244,604 (GRCm39)	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69,252,510 (GRCm39)	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69,254,857 (GRCm39)	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69,243,371 (GRCm39)	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69,240,938 (GRCm39)	nonsense	probably null
R6548:Chd3	UTSW	11	69,252,886 (GRCm39)	nonsense	probably null
R6582:Chd3	UTSW	11	69,259,982 (GRCm39)	unclassified	probably benign
R6721:Chd3	UTSW	11	69,260,045 (GRCm39)	unclassified	probably benign
R6776:Chd3	UTSW	11	69,245,296 (GRCm39)	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69,260,027 (GRCm39)	missense	unknown
R7136:Chd3	UTSW	11	69,239,264 (GRCm39)	missense	probably null	0.37
R7164:Chd3	UTSW	11	69,253,132 (GRCm39)	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69,254,921 (GRCm39)	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69,260,037 (GRCm39)	missense	unknown
R7238:Chd3	UTSW	11	69,254,873 (GRCm39)	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69,236,394 (GRCm39)	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69,247,096 (GRCm39)	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69,248,692 (GRCm39)	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69,246,459 (GRCm39)	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69,244,064 (GRCm39)	missense	probably damaging	1.00
R7885:Chd3	UTSW	11	69,247,451 (GRCm39)	missense	probably benign	0.13
R8161:Chd3	UTSW	11	69,241,711 (GRCm39)	missense	probably damaging	1.00
R8271:Chd3	UTSW	11	69,251,483 (GRCm39)	missense	probably damaging	1.00
R8334:Chd3	UTSW	11	69,241,622 (GRCm39)	missense	probably damaging	1.00
R8423:Chd3	UTSW	11	69,245,252 (GRCm39)	nonsense	probably null
R8690:Chd3	UTSW	11	69,246,648 (GRCm39)	critical splice acceptor site	probably benign
R8828:Chd3	UTSW	11	69,247,097 (GRCm39)	missense	probably damaging	1.00
R8857:Chd3	UTSW	11	69,253,146 (GRCm39)	missense	probably benign	0.22
R9124:Chd3	UTSW	11	69,260,162 (GRCm39)	missense	unknown
R9170:Chd3	UTSW	11	69,241,648 (GRCm39)	missense	possibly damaging	0.64
R9213:Chd3	UTSW	11	69,255,628 (GRCm39)	missense	possibly damaging	0.53
R9285:Chd3	UTSW	11	69,249,954 (GRCm39)	missense	possibly damaging	0.64
R9293:Chd3	UTSW	11	69,244,027 (GRCm39)	missense	possibly damaging	0.94
R9368:Chd3	UTSW	11	69,251,200 (GRCm39)	missense	probably damaging	1.00
R9521:Chd3	UTSW	11	69,249,133 (GRCm39)	missense	probably benign	0.01
R9544:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
R9554:Chd3	UTSW	11	69,251,015 (GRCm39)	missense	probably damaging	1.00
R9588:Chd3	UTSW	11	69,241,046 (GRCm39)	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69,247,084 (GRCm39)	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69,245,271 (GRCm39)	missense	possibly damaging	0.64
Z1186:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1186:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1187:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1187:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1188:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1188:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1189:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1189:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1190:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1190:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1191:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1191:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00
Z1192:Chd3	UTSW	11	69,252,277 (GRCm39)	missense	probably benign
Z1192:Chd3	UTSW	11	69,239,271 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GATTGGTTGACCCCAGACCAAG -3'
(R):5'- ATGGGGACTGGACTACACAG -3'

Sequencing Primer
(F):5'- GCACATGCCATGAATTTCTCTAGGAC -3'
(R):5'- CTGGACTACACAGGGGAGC -3'

Posted On

2020-06-30