Incidental Mutation 'R8150:Serpina3f'
ID632923
Institutional Source Beutler Lab
Gene Symbol Serpina3f
Ensembl Gene ENSMUSG00000066363
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms2A1, alpha-1 antiproteinasin, antitrypsin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8150 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location104214544-104221129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104219510 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 325 (F325L)
Ref Sequence ENSEMBL: ENSMUSP00000098641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101080] [ENSMUST00000121337] [ENSMUST00000167049]
Predicted Effect probably damaging
Transcript: ENSMUST00000101080
AA Change: F325L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098641
Gene: ENSMUSG00000066363
AA Change: F325L

DomainStartEndE-ValueType
SERPIN 46 408 1.58e-186 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121337
AA Change: F325L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113945
Gene: ENSMUSG00000066363
AA Change: F325L

DomainStartEndE-ValueType
SERPIN 46 408 1.58e-186 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167049
AA Change: F325L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126520
Gene: ENSMUSG00000066363
AA Change: F325L

DomainStartEndE-ValueType
SERPIN 46 408 1.58e-186 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,533,824 M129L probably benign Het
Abca2 T C 2: 25,447,381 I2416T probably damaging Het
Abca3 A G 17: 24,396,548 D871G probably benign Het
Akap9 C T 5: 3,961,982 T895I probably damaging Het
Aldh8a1 A G 10: 21,395,545 E390G probably damaging Het
Ank2 T A 3: 126,947,513 D1574V Het
Blmh T C 11: 76,968,629 V352A probably benign Het
C130079G13Rik A G 3: 59,936,137 D84G probably damaging Het
Cacna1i T C 15: 80,375,339 L1270P probably damaging Het
Ccdc80 T A 16: 45,127,429 H923Q probably damaging Het
Cdc27 G A 11: 104,515,460 H610Y probably damaging Het
Cep126 T C 9: 8,101,790 I248V probably benign Het
Ces5a T C 8: 93,530,802 N125S probably damaging Het
Chd3 G A 11: 69,363,684 H201Y probably benign Het
Cpeb1 T C 7: 81,357,404 T292A probably damaging Het
Gli2 G A 1: 118,835,828 T1531I probably damaging Het
Gm6871 T C 7: 41,547,761 T7A Het
Kank1 A G 19: 25,410,799 D612G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Mfsd6 T A 1: 52,708,641 D355V probably benign Het
Myo7a T C 7: 98,063,639 K1710E probably benign Het
Olfr270 C G 4: 52,970,788 H56D probably damaging Het
Olfr608 A G 7: 103,470,252 D71G probably damaging Het
Pcdha8 G A 18: 36,993,211 V249M probably damaging Het
Pglyrp3 A G 3: 92,026,483 D145G probably benign Het
Pkhd1l1 A G 15: 44,546,659 K2521E possibly damaging Het
Pld3 A G 7: 27,532,661 V398A probably damaging Het
Plxnb1 A T 9: 109,112,078 T1642S probably damaging Het
Ppp2r1a T G 17: 20,959,438 V348G possibly damaging Het
Prdm2 C A 4: 143,132,733 C1329F possibly damaging Het
Ric8a G T 7: 140,861,356 G423V probably damaging Het
Rnf17 A G 14: 56,421,136 D94G probably benign Het
Sin3a T A 9: 57,127,284 V1247E possibly damaging Het
Skint5 C A 4: 113,940,890 M165I probably benign Het
Slc19a3 T G 1: 83,022,495 Y267S probably damaging Het
Slc22a27 A T 19: 7,910,025 F196Y possibly damaging Het
Slc5a4b A T 10: 76,103,846 I152N possibly damaging Het
Tbc1d9 T A 8: 83,255,890 V768E probably damaging Het
Tex15 T A 8: 33,573,506 M988K probably benign Het
Top2b T A 14: 16,393,291 F317I probably damaging Het
Wfdc8 A T 2: 164,597,535 L309* probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp949 C T 9: 88,570,000 T541I probably benign Het
Zkscan16 T A 4: 58,952,407 I235N probably benign Het
Other mutations in Serpina3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Serpina3f APN 12 104217340 missense probably benign 0.44
IGL01375:Serpina3f APN 12 104220476 missense unknown
IGL01575:Serpina3f APN 12 104218440 missense probably damaging 1.00
IGL01712:Serpina3f APN 12 104218398 missense probably damaging 1.00
IGL02001:Serpina3f APN 12 104219466 missense probably damaging 1.00
IGL02882:Serpina3f APN 12 104217004 missense probably damaging 1.00
IGL03145:Serpina3f APN 12 104217457 missense probably benign 0.06
R0158:Serpina3f UTSW 12 104217008 missense probably damaging 1.00
R0739:Serpina3f UTSW 12 104218353 missense probably damaging 1.00
R1667:Serpina3f UTSW 12 104217440 missense probably damaging 1.00
R1800:Serpina3f UTSW 12 104217406 missense probably damaging 1.00
R2010:Serpina3f UTSW 12 104217323 missense probably damaging 1.00
R2356:Serpina3f UTSW 12 104217367 nonsense probably null
R3926:Serpina3f UTSW 12 104219481 missense possibly damaging 0.58
R3959:Serpina3f UTSW 12 104217140 missense probably damaging 1.00
R4619:Serpina3f UTSW 12 104217290 missense possibly damaging 0.93
R4765:Serpina3f UTSW 12 104219431 missense probably benign 0.03
R4977:Serpina3f UTSW 12 104217055 missense probably benign 0.00
R4994:Serpina3f UTSW 12 104220356 missense probably benign 0.04
R5432:Serpina3f UTSW 12 104220318 missense possibly damaging 0.79
R5733:Serpina3f UTSW 12 104216923 missense possibly damaging 0.63
R7670:Serpina3f UTSW 12 104217266 missense probably damaging 1.00
R7727:Serpina3f UTSW 12 104218218 missense probably benign 0.37
R7754:Serpina3f UTSW 12 104217306 missense possibly damaging 0.69
X0028:Serpina3f UTSW 12 104217271 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAAAGTCAAGTTGTGTTGGCATG -3'
(R):5'- ATTAAGCTCTCCCCGGCATG -3'

Sequencing Primer
(F):5'- GGACTTCCCTGTAATTAGAGGACTC -3'
(R):5'- GAGGCAAACAGAAGTACAGGTGTTC -3'
Posted On2020-06-30