Incidental Mutation 'R8150:Abca3'
ID632930
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene NameATP-binding cassette, sub-family A (ABC1), member 3
SynonymsABC-C, 1810036E22Rik, Abc3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8150 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24351950-24410201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24396548 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 871 (D871G)
Ref Sequence ENSEMBL: ENSMUSP00000045285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
Predicted Effect probably benign
Transcript: ENSMUST00000039013
AA Change: D871G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: D871G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079594
AA Change: D871G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: D871G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117337
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,533,824 M129L probably benign Het
Abca2 T C 2: 25,447,381 I2416T probably damaging Het
Akap9 C T 5: 3,961,982 T895I probably damaging Het
Aldh8a1 A G 10: 21,395,545 E390G probably damaging Het
Ank2 T A 3: 126,947,513 D1574V Het
Blmh T C 11: 76,968,629 V352A probably benign Het
C130079G13Rik A G 3: 59,936,137 D84G probably damaging Het
Cacna1i T C 15: 80,375,339 L1270P probably damaging Het
Ccdc80 T A 16: 45,127,429 H923Q probably damaging Het
Cdc27 G A 11: 104,515,460 H610Y probably damaging Het
Cep126 T C 9: 8,101,790 I248V probably benign Het
Ces5a T C 8: 93,530,802 N125S probably damaging Het
Chd3 G A 11: 69,363,684 H201Y probably benign Het
Cpeb1 T C 7: 81,357,404 T292A probably damaging Het
Gli2 G A 1: 118,835,828 T1531I probably damaging Het
Gm6871 T C 7: 41,547,761 T7A Het
Kank1 A G 19: 25,410,799 D612G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Mfsd6 T A 1: 52,708,641 D355V probably benign Het
Myo7a T C 7: 98,063,639 K1710E probably benign Het
Olfr270 C G 4: 52,970,788 H56D probably damaging Het
Olfr608 A G 7: 103,470,252 D71G probably damaging Het
Pcdha8 G A 18: 36,993,211 V249M probably damaging Het
Pglyrp3 A G 3: 92,026,483 D145G probably benign Het
Pkhd1l1 A G 15: 44,546,659 K2521E possibly damaging Het
Pld3 A G 7: 27,532,661 V398A probably damaging Het
Plxnb1 A T 9: 109,112,078 T1642S probably damaging Het
Ppp2r1a T G 17: 20,959,438 V348G possibly damaging Het
Prdm2 C A 4: 143,132,733 C1329F possibly damaging Het
Ric8a G T 7: 140,861,356 G423V probably damaging Het
Rnf17 A G 14: 56,421,136 D94G probably benign Het
Serpina3f T C 12: 104,219,510 F325L probably damaging Het
Sin3a T A 9: 57,127,284 V1247E possibly damaging Het
Skint5 C A 4: 113,940,890 M165I probably benign Het
Slc19a3 T G 1: 83,022,495 Y267S probably damaging Het
Slc22a27 A T 19: 7,910,025 F196Y possibly damaging Het
Slc5a4b A T 10: 76,103,846 I152N possibly damaging Het
Tbc1d9 T A 8: 83,255,890 V768E probably damaging Het
Tex15 T A 8: 33,573,506 M988K probably benign Het
Top2b T A 14: 16,393,291 F317I probably damaging Het
Wfdc8 A T 2: 164,597,535 L309* probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp949 C T 9: 88,570,000 T541I probably benign Het
Zkscan16 T A 4: 58,952,407 I235N probably benign Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1348:Abca3 UTSW 17 24374238 splice site probably null
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24384564 missense probably damaging 1.00
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5022:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24384535 missense probably damaging 1.00
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
R7338:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R7430:Abca3 UTSW 17 24364958 critical splice donor site probably null
R7437:Abca3 UTSW 17 24400498 missense probably damaging 0.99
R7776:Abca3 UTSW 17 24386276 missense possibly damaging 0.77
R7805:Abca3 UTSW 17 24405154 critical splice donor site probably null
R7811:Abca3 UTSW 17 24397388 missense probably benign 0.00
R7848:Abca3 UTSW 17 24384532 missense probably damaging 1.00
R7859:Abca3 UTSW 17 24384526 missense probably damaging 1.00
R7877:Abca3 UTSW 17 24384023 nonsense probably null
R7893:Abca3 UTSW 17 24385466 missense probably damaging 1.00
R7910:Abca3 UTSW 17 24385853 missense probably benign 0.09
R7911:Abca3 UTSW 17 24398504 missense probably damaging 1.00
R7964:Abca3 UTSW 17 24402436 missense probably benign 0.26
R8016:Abca3 UTSW 17 24364952 missense probably benign 0.06
R8028:Abca3 UTSW 17 24407697 missense probably benign 0.02
R8298:Abca3 UTSW 17 24385401 missense probably damaging 1.00
R8444:Abca3 UTSW 17 24383985 missense probably damaging 0.98
R8505:Abca3 UTSW 17 24374497 missense probably damaging 0.97
R8547:Abca3 UTSW 17 24397500 missense probably benign 0.00
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Z1177:Abca3 UTSW 17 24408236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGTTACGCTTCAGAGCC -3'
(R):5'- CAGCTGTAATCTGCCCTCTG -3'

Sequencing Primer
(F):5'- ACGCTTCAGAGCCTCTTTTTAAAG -3'
(R):5'- TTTTCTACCGTGGGGACGCC -3'
Posted On2020-06-30