Incidental Mutation 'R8151:Ptprt'
ID 632938
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase, receptor type, T
Synonyms RPTPrho
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R8151 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 161521990-162661147 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 162278085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 154 (E154G)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: E154G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: E154G

signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: E154G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: E154G

signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: E154G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: E154G

signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: E154G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: E154G

signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.6655 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,153,341 I1351T possibly damaging Het
Ahnak T C 19: 9,004,679 I1109T possibly damaging Het
Aipl1 C A 11: 72,036,758 D44Y probably benign Het
Aldh8a1 C T 10: 21,395,566 T397M probably damaging Het
Armc4 A G 18: 7,127,358 F952L probably damaging Het
Btbd16 T C 7: 130,797,095 S278P probably damaging Het
Ccdc110 G A 8: 45,942,793 E574K probably damaging Het
Cd19 T A 7: 126,414,306 K104* probably null Het
Cenpe A G 3: 135,247,022 E1491G probably benign Het
Col12a1 A T 9: 79,630,549 S2546T possibly damaging Het
Col18a1 T C 10: 77,112,584 T365A unknown Het
Ctif G T 18: 75,520,105 D360E probably benign Het
Fam160a1 A T 3: 85,688,540 I346N probably damaging Het
Fat4 G A 3: 38,892,054 E1699K probably damaging Het
Fbxo39 G A 11: 72,317,700 V293M probably damaging Het
Havcr2 A G 11: 46,475,895 K221E possibly damaging Het
Hdac5 T C 11: 102,206,468 T209A probably benign Het
Herc1 A G 9: 66,433,791 Q1730R probably damaging Het
Ifi202b T C 1: 173,977,357 T10A probably benign Het
Il18rap T C 1: 40,525,268 S153P probably benign Het
Klk1b21 C T 7: 44,104,363 R24* probably null Het
Kras ACTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTC 6: 145,220,634 probably benign Het
Ldlrad4 A G 18: 68,250,572 E113G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 615 probably null Het
Macf1 T C 4: 123,397,413 E3895G possibly damaging Het
Mug1 T C 6: 121,841,158 S143P probably benign Het
Nudcd2 A T 11: 40,733,702 probably benign Het
Nup85 A G 11: 115,577,933 T201A probably benign Het
Plppr2 A G 9: 21,940,809 E64G probably damaging Het
Plvap A G 8: 71,507,981 S264P probably benign Het
Polm T C 11: 5,837,906 probably benign Het
Polr2d T A 18: 31,795,312 H93Q probably damaging Het
Rasal2 C A 1: 157,243,584 G67C probably damaging Het
Sdk2 A G 11: 113,872,857 V329A possibly damaging Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Spef2 A G 15: 9,601,512 S1555P unknown Het
Srgap3 A C 6: 112,816,667 L116R probably damaging Het
St6galnac3 C T 3: 153,411,580 V169M probably damaging Het
Stx16 T A 2: 174,093,491 M206K possibly damaging Het
Txnip A G 3: 96,559,613 D201G possibly damaging Het
Ubr4 T C 4: 139,402,801 V718A probably damaging Het
Vav3 A C 3: 109,508,848 D261A probably benign Het
Vcam1 A C 3: 116,124,479 L278V possibly damaging Het
Vta1 C A 10: 14,667,953 A226S probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp777 G A 6: 48,029,141 Q440* probably null Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
R8236:Ptprt UTSW 2 161687068 critical splice donor site probably null
R8308:Ptprt UTSW 2 161927646 missense probably benign 0.00
R8348:Ptprt UTSW 2 161558886 missense probably damaging 1.00
R8362:Ptprt UTSW 2 161551747 missense probably damaging 1.00
R8365:Ptprt UTSW 2 161901531 missense probably benign 0.05
R8448:Ptprt UTSW 2 161558886 missense probably damaging 1.00
R8512:Ptprt UTSW 2 161558863 missense probably benign 0.00
R8715:Ptprt UTSW 2 161530543 missense probably damaging 1.00
R9004:Ptprt UTSW 2 161766394 missense probably benign 0.04
R9046:Ptprt UTSW 2 161530441 missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161560186 missense probably damaging 1.00
R9297:Ptprt UTSW 2 161575778 missense probably benign
R9318:Ptprt UTSW 2 161575778 missense probably benign
R9476:Ptprt UTSW 2 161555461 missense probably damaging 1.00
R9510:Ptprt UTSW 2 161555461 missense probably damaging 1.00
R9571:Ptprt UTSW 2 161553812 missense probably benign 0.10
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2020-06-30