Incidental Mutation 'R0102:Shcbp1'
ID63295
Institutional Source Beutler Lab
Gene Symbol Shcbp1
Ensembl Gene ENSMUSG00000022322
Gene NameShc SH2-domain binding protein 1
SynonymsmPAL
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0102 (G1)
Quality Score181
Status Validated
Chromosome8
Chromosomal Location4735976-4779567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4744452 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 447 (I447T)
Ref Sequence ENSEMBL: ENSMUSP00000022945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022945]
Predicted Effect probably damaging
Transcript: ENSMUST00000022945
AA Change: I447T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: I447T

DomainStartEndE-ValueType
low complexity region 210 219 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
PbH1 428 451 8.61e3 SMART
PbH1 452 473 2.38e3 SMART
PbH1 474 496 9.62e2 SMART
PbH1 497 518 1.07e2 SMART
PbH1 526 548 1.74e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207665
Predicted Effect probably benign
Transcript: ENSMUST00000207876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208856
Meta Mutation Damage Score 0.9469 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Shcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Shcbp1 APN 8 4754258 nonsense probably null
IGL01330:Shcbp1 APN 8 4736372 missense probably benign 0.00
IGL01878:Shcbp1 APN 8 4749721 missense probably damaging 0.98
IGL02415:Shcbp1 APN 8 4754239 missense possibly damaging 0.93
IGL02559:Shcbp1 APN 8 4749305 missense probably damaging 0.98
IGL03171:Shcbp1 APN 8 4739166 missense probably benign 0.05
IGL03348:Shcbp1 APN 8 4765089 missense probably benign 0.10
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0729:Shcbp1 UTSW 8 4736297 missense probably benign 0.05
R0743:Shcbp1 UTSW 8 4764906 missense probably benign
R1413:Shcbp1 UTSW 8 4741968 critical splice acceptor site probably null
R1630:Shcbp1 UTSW 8 4748763 nonsense probably null
R1645:Shcbp1 UTSW 8 4749645 missense probably benign 0.00
R3778:Shcbp1 UTSW 8 4736295 missense probably benign 0.01
R4066:Shcbp1 UTSW 8 4748716 missense probably damaging 0.98
R4232:Shcbp1 UTSW 8 4736372 missense probably benign 0.06
R4524:Shcbp1 UTSW 8 4739193 missense probably damaging 1.00
R4552:Shcbp1 UTSW 8 4749779 nonsense probably null
R4623:Shcbp1 UTSW 8 4739178 missense probably damaging 1.00
R4748:Shcbp1 UTSW 8 4744512 missense probably damaging 1.00
R5093:Shcbp1 UTSW 8 4739214 missense possibly damaging 0.68
R5152:Shcbp1 UTSW 8 4736138 missense probably damaging 1.00
R5540:Shcbp1 UTSW 8 4744529 missense probably damaging 1.00
R5758:Shcbp1 UTSW 8 4749355 unclassified probably null
R5878:Shcbp1 UTSW 8 4748742 missense probably benign 0.04
R6062:Shcbp1 UTSW 8 4764905 missense probably benign 0.13
R6366:Shcbp1 UTSW 8 4749380 missense probably damaging 1.00
R6394:Shcbp1 UTSW 8 4736176 missense probably damaging 0.99
R6513:Shcbp1 UTSW 8 4744507 missense probably benign
R6696:Shcbp1 UTSW 8 4739262 missense probably damaging 1.00
R7014:Shcbp1 UTSW 8 4754234 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4741876 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4754310 missense probably damaging 1.00
R7420:Shcbp1 UTSW 8 4748737 missense probably benign 0.02
R7710:Shcbp1 UTSW 8 4764965 missense probably benign 0.14
R7720:Shcbp1 UTSW 8 4748720 missense probably damaging 1.00
R7756:Shcbp1 UTSW 8 4744545 missense probably damaging 0.97
R7769:Shcbp1 UTSW 8 4739232 missense probably damaging 1.00
X0062:Shcbp1 UTSW 8 4739249 missense probably damaging 0.99
Z1176:Shcbp1 UTSW 8 4765056 missense possibly damaging 0.59
Z1177:Shcbp1 UTSW 8 4736146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTACTACTAGGTCCCACCTCTGAA -3'
(R):5'- GTGCTCCCTCTGACCATGAAATCTTT -3'

Sequencing Primer
(F):5'- acaaacaaacaaacaaacaaacaac -3'
(R):5'- atgtgcttcattcttattgttcattc -3'
Posted On2013-07-30