Incidental Mutation 'R8151:Klk1b21'
ID632955
Institutional Source Beutler Lab
Gene Symbol Klk1b21
Ensembl Gene ENSMUSG00000066516
Gene Namekallikrein 1-related peptidase b21
SynonymsKlk21, mGk-21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8151 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44102328-44106583 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 44104363 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 24 (R24*)
Ref Sequence ENSEMBL: ENSMUSP00000082582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085455]
Predicted Effect probably null
Transcript: ENSMUST00000085455
AA Change: R24*
SMART Domains Protein: ENSMUSP00000082582
Gene: ENSMUSG00000066516
AA Change: R24*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 9.09e-96 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,153,341 I1351T possibly damaging Het
Ahnak T C 19: 9,004,679 I1109T possibly damaging Het
Aipl1 C A 11: 72,036,758 D44Y probably benign Het
Aldh8a1 C T 10: 21,395,566 T397M probably damaging Het
Armc4 A G 18: 7,127,358 F952L probably damaging Het
Btbd16 T C 7: 130,797,095 S278P probably damaging Het
Ccdc110 G A 8: 45,942,793 E574K probably damaging Het
Cd19 T A 7: 126,414,306 K104* probably null Het
Cenpe A G 3: 135,247,022 E1491G probably benign Het
Col12a1 A T 9: 79,630,549 S2546T possibly damaging Het
Col18a1 T C 10: 77,112,584 T365A unknown Het
Ctif G T 18: 75,520,105 D360E probably benign Het
Fam160a1 A T 3: 85,688,540 I346N probably damaging Het
Fat4 G A 3: 38,892,054 E1699K probably damaging Het
Fbxo39 G A 11: 72,317,700 V293M probably damaging Het
Havcr2 A G 11: 46,475,895 K221E possibly damaging Het
Hdac5 T C 11: 102,206,468 T209A probably benign Het
Herc1 A G 9: 66,433,791 Q1730R probably damaging Het
Ifi202b T C 1: 173,977,357 T10A probably benign Het
Il18rap T C 1: 40,525,268 S153P probably benign Het
Kras ACTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTC 6: 145,220,634 probably benign Het
Ldlrad4 A G 18: 68,250,572 E113G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Macf1 T C 4: 123,397,413 E3895G possibly damaging Het
Mug1 T C 6: 121,841,158 S143P probably benign Het
Nudcd2 A T 11: 40,733,702 probably benign Het
Nup85 A G 11: 115,577,933 T201A probably benign Het
Plppr2 A G 9: 21,940,809 E64G probably damaging Het
Plvap A G 8: 71,507,981 S264P probably benign Het
Polm T C 11: 5,837,906 probably benign Het
Polr2d T A 18: 31,795,312 H93Q probably damaging Het
Ptprt T C 2: 162,278,085 E154G probably damaging Het
Rasal2 C A 1: 157,243,584 G67C probably damaging Het
Sdk2 A G 11: 113,872,857 V329A possibly damaging Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Spef2 A G 15: 9,601,512 S1555P unknown Het
Srgap3 A C 6: 112,816,667 L116R probably damaging Het
St6galnac3 C T 3: 153,411,580 V169M probably damaging Het
Stx16 T A 2: 174,093,491 M206K possibly damaging Het
Txnip A G 3: 96,559,613 D201G possibly damaging Het
Ubr4 T C 4: 139,402,801 V718A probably damaging Het
Vav3 A C 3: 109,508,848 D261A probably benign Het
Vcam1 A C 3: 116,124,479 L278V possibly damaging Het
Vta1 C A 10: 14,667,953 A226S probably damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp777 G A 6: 48,029,141 Q440* probably null Het
Other mutations in Klk1b21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Klk1b21 APN 7 44105923 missense possibly damaging 0.81
IGL01710:Klk1b21 APN 7 44106495 missense probably benign 0.13
IGL02015:Klk1b21 APN 7 44104358 missense probably benign 0.41
R0138:Klk1b21 UTSW 7 44105895 missense probably damaging 1.00
R0384:Klk1b21 UTSW 7 44105493 missense probably benign 0.03
R1456:Klk1b21 UTSW 7 44105499 missense probably benign 0.01
R2021:Klk1b21 UTSW 7 44105994 nonsense probably null
R2119:Klk1b21 UTSW 7 44105769 missense probably benign
R2265:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R2267:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R2269:Klk1b21 UTSW 7 44104439 missense possibly damaging 0.51
R5499:Klk1b21 UTSW 7 44105676 missense probably benign 0.07
R5623:Klk1b21 UTSW 7 44105565 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATTATACCTGATCCCTGATTCAG -3'
(R):5'- AGTCATGTTCTCTGGCTGCC -3'

Sequencing Primer
(F):5'- AGGAATTCTTTCTATACCCACAGC -3'
(R):5'- GCTGCCACCCTGCTTTCATG -3'
Posted On2020-06-30