Incidental Mutation 'R8151:Vta1'
ID632964
Institutional Source Beutler Lab
Gene Symbol Vta1
Ensembl Gene ENSMUSG00000019868
Gene Namevesicle (multivesicular body) trafficking 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R8151 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location14654755-14705560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14667953 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 226 (A226S)
Ref Sequence ENSEMBL: ENSMUSP00000119829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020018] [ENSMUST00000133927] [ENSMUST00000154132]
Predicted Effect probably benign
Transcript: ENSMUST00000020018
Predicted Effect silent
Transcript: ENSMUST00000133927
SMART Domains Protein: ENSMUSP00000119958
Gene: ENSMUSG00000019868

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000118498
Gene: ENSMUSG00000019868
AA Change: A225S

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:Vta1 16 158 2.2e-50 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 184 197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154132
AA Change: A226S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119829
Gene: ENSMUSG00000019868
AA Change: A226S

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Vta1 16 158 1.6e-53 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 184 197 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C6ORF55 encodes a protein involved in trafficking of the multivesicular body, an endosomal compartment involved in sorting membrane proteins for degradation in lysosomes (Ward et al., 2005 [PubMed 15644320]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,153,341 I1351T possibly damaging Het
Ahnak T C 19: 9,004,679 I1109T possibly damaging Het
Aipl1 C A 11: 72,036,758 D44Y probably benign Het
Aldh8a1 C T 10: 21,395,566 T397M probably damaging Het
Armc4 A G 18: 7,127,358 F952L probably damaging Het
Btbd16 T C 7: 130,797,095 S278P probably damaging Het
Ccdc110 G A 8: 45,942,793 E574K probably damaging Het
Cd19 T A 7: 126,414,306 K104* probably null Het
Cenpe A G 3: 135,247,022 E1491G probably benign Het
Col12a1 A T 9: 79,630,549 S2546T possibly damaging Het
Col18a1 T C 10: 77,112,584 T365A unknown Het
Ctif G T 18: 75,520,105 D360E probably benign Het
Fam160a1 A T 3: 85,688,540 I346N probably damaging Het
Fat4 G A 3: 38,892,054 E1699K probably damaging Het
Fbxo39 G A 11: 72,317,700 V293M probably damaging Het
Havcr2 A G 11: 46,475,895 K221E possibly damaging Het
Hdac5 T C 11: 102,206,468 T209A probably benign Het
Herc1 A G 9: 66,433,791 Q1730R probably damaging Het
Ifi202b T C 1: 173,977,357 T10A probably benign Het
Il18rap T C 1: 40,525,268 S153P probably benign Het
Klk1b21 C T 7: 44,104,363 R24* probably null Het
Kras ACTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTC 6: 145,220,634 probably benign Het
Ldlrad4 A G 18: 68,250,572 E113G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Macf1 T C 4: 123,397,413 E3895G possibly damaging Het
Mug1 T C 6: 121,841,158 S143P probably benign Het
Nudcd2 A T 11: 40,733,702 probably benign Het
Nup85 A G 11: 115,577,933 T201A probably benign Het
Plppr2 A G 9: 21,940,809 E64G probably damaging Het
Plvap A G 8: 71,507,981 S264P probably benign Het
Polm T C 11: 5,837,906 probably benign Het
Polr2d T A 18: 31,795,312 H93Q probably damaging Het
Ptprt T C 2: 162,278,085 E154G probably damaging Het
Rasal2 C A 1: 157,243,584 G67C probably damaging Het
Sdk2 A G 11: 113,872,857 V329A possibly damaging Het
Sorl1 A G 9: 42,067,933 V423A probably damaging Het
Spef2 A G 15: 9,601,512 S1555P unknown Het
Srgap3 A C 6: 112,816,667 L116R probably damaging Het
St6galnac3 C T 3: 153,411,580 V169M probably damaging Het
Stx16 T A 2: 174,093,491 M206K possibly damaging Het
Txnip A G 3: 96,559,613 D201G possibly damaging Het
Ubr4 T C 4: 139,402,801 V718A probably damaging Het
Vav3 A C 3: 109,508,848 D261A probably benign Het
Vcam1 A C 3: 116,124,479 L278V possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp777 G A 6: 48,029,141 Q440* probably null Het
Other mutations in Vta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Vta1 APN 10 14684131 missense probably damaging 0.98
IGL02331:Vta1 APN 10 14705394 missense probably damaging 1.00
IGL03161:Vta1 APN 10 14667972 missense possibly damaging 0.54
R2680:Vta1 UTSW 10 14705427 unclassified probably benign
R4751:Vta1 UTSW 10 14655816 missense probably benign 0.03
R5064:Vta1 UTSW 10 14705478 unclassified probably benign
R5288:Vta1 UTSW 10 14705399 missense probably damaging 0.98
R5635:Vta1 UTSW 10 14668122 splice site probably null
R6146:Vta1 UTSW 10 14705352 missense probably damaging 1.00
R7853:Vta1 UTSW 10 14655717 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATACCCTAGAGCCTGTAAGCCAG -3'
(R):5'- AATGGTATTCATTGTCAGCCAC -3'

Sequencing Primer
(F):5'- GCCTGTAAGCCAGATGAATTAC -3'
(R):5'- CAATGATTTCAAGAAATAGCCTGC -3'
Posted On2020-06-30