Incidental Mutation 'R0102:Shbg'
ID63299
Institutional Source Beutler Lab
Gene Symbol Shbg
Ensembl Gene ENSMUSG00000005202
Gene Namesex hormone binding globulin
Synonyms
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R0102 (G1)
Quality Score154
Status Validated
Chromosome11
Chromosomal Location69614804-69617905 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 69617589 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005334] [ENSMUST00000092969] [ENSMUST00000108656]
Predicted Effect probably benign
Transcript: ENSMUST00000005334
SMART Domains Protein: ENSMUSP00000005334
Gene: ENSMUSG00000005202

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LamG 68 203 2.59e-21 SMART
LamG 249 372 7.71e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092969
SMART Domains Protein: ENSMUSP00000090647
Gene: ENSMUSG00000069835

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 13 144 1.4e-8 PFAM
Pfam:Acetyltransf_7 63 145 3e-11 PFAM
Pfam:Acetyltransf_1 66 146 2.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108656
SMART Domains Protein: ENSMUSP00000104296
Gene: ENSMUSG00000069835

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 53 144 3.2e-10 PFAM
Pfam:Acetyltransf_1 65 146 5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151255
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a steroid binding protein that was first described as a plasma protein secreted by the liver but is now thought to participate in the regulation of steroid responses. The encoded protein transports androgens and estrogens in the blood, binding each steroid molecule as a dimer formed from identical or nearly identical monomers. Polymorphisms in this gene have been associated with polycystic ovary syndrome and type 2 diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Cyp2d10 C T 15: 82,404,593 M229I probably benign Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Shbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Shbg APN 11 69617209 missense probably damaging 1.00
IGL03401:Shbg APN 11 69615099 missense probably damaging 1.00
R0102:Shbg UTSW 11 69617589 unclassified probably benign
R0968:Shbg UTSW 11 69617188 missense probably damaging 1.00
R1569:Shbg UTSW 11 69617589 unclassified probably benign
R1714:Shbg UTSW 11 69617157 missense possibly damaging 0.74
R1721:Shbg UTSW 11 69614972 missense probably damaging 0.97
R4735:Shbg UTSW 11 69617500 missense possibly damaging 0.64
R4903:Shbg UTSW 11 69615086 missense probably benign 0.00
R4956:Shbg UTSW 11 69617219 missense probably damaging 1.00
R5524:Shbg UTSW 11 69616762 missense probably benign 0.00
R5543:Shbg UTSW 11 69616738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGTTCGAAACTCAAAGGAGG -3'
(R):5'- TGTTGCTACTACTGATGCCGCC -3'

Sequencing Primer
(F):5'- CTCAAAGGAGGAATGGGGTCTG -3'
(R):5'- TGACCCTGGAACTGTACCTTTC -3'
Posted On2013-07-30