Incidental Mutation 'R8152:Tex15'
ID 633016
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Name testis expressed gene 15
Synonyms 2210014E14Rik
MMRRC Submission 067578-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.291) question?
Stock # R8152 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 34006766-34075610 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34062921 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 784 (E784K)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000009772
AA Change: E784K

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: E784K

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124496
AA Change: E1058K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: E1058K

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 92.4%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,044,305 (GRCm39) L195P probably damaging Het
Adgrb1 T C 15: 74,413,460 (GRCm39) V548A probably benign Het
Adgrb1 T C 15: 74,416,849 (GRCm39) I752T probably damaging Het
Adgrb3 T C 1: 25,260,838 (GRCm39) probably null Het
Adh6a G T 3: 138,033,275 (GRCm39) probably null Het
Aldh18a1 A G 19: 40,553,456 (GRCm39) S431P probably benign Het
Arap3 T C 18: 38,124,410 (GRCm39) R310G possibly damaging Het
Atad5 T C 11: 79,985,996 (GRCm39) V361A possibly damaging Het
Atp8a1 C A 5: 67,919,925 (GRCm39) M380I Het
Calcrl C T 2: 84,169,593 (GRCm39) V363M possibly damaging Het
Camsap1 G T 2: 25,830,253 (GRCm39) D490E probably damaging Het
Cd72 T A 4: 43,452,601 (GRCm39) I131F possibly damaging Het
Cdh2 C T 18: 16,762,576 (GRCm39) G513D probably benign Het
Cela1 T C 15: 100,580,822 (GRCm39) T145A probably benign Het
Cep250 A G 2: 155,811,227 (GRCm39) T358A probably benign Het
Cfap99 C T 5: 34,480,735 (GRCm39) R462C probably damaging Het
Cmtm1 A G 8: 105,036,573 (GRCm39) S19P possibly damaging Het
Crebbp A T 16: 3,902,945 (GRCm39) M2098K possibly damaging Het
Csmd3 T C 15: 47,532,860 (GRCm39) probably null Het
Ctsm C G 13: 61,687,463 (GRCm39) V100L probably benign Het
Cyp2c67 C A 19: 39,628,452 (GRCm39) C164F probably benign Het
Cyp2d11 T C 15: 82,276,688 (GRCm39) I84V probably benign Het
Cyp2j11 T C 4: 96,195,529 (GRCm39) D389G probably damaging Het
Dctd A G 8: 48,564,725 (GRCm39) D9G probably benign Het
Fam221a C A 6: 49,355,490 (GRCm39) F197L probably damaging Het
Fbxl4 T G 4: 22,427,225 (GRCm39) C489G possibly damaging Het
Fmn1 C T 2: 113,196,037 (GRCm39) T579M unknown Het
Fndc3a G A 14: 72,811,820 (GRCm39) L337F probably damaging Het
Frmpd2 A G 14: 33,265,244 (GRCm39) probably null Het
Gdnf C T 15: 7,864,243 (GRCm39) S218L probably damaging Het
Gen1 A G 12: 11,293,266 (GRCm39) F444L probably damaging Het
Gk5 A T 9: 96,056,756 (GRCm39) D391V probably damaging Het
Gys2 T C 6: 142,373,136 (GRCm39) T612A probably benign Het
Il17ra A G 6: 120,459,063 (GRCm39) D738G probably benign Het
Isx T C 8: 75,616,627 (GRCm39) F85L probably damaging Het
Kcnh5 T C 12: 74,944,633 (GRCm39) D872G possibly damaging Het
Kif26b T G 1: 178,506,794 (GRCm39) V290G possibly damaging Het
Ksr2 T C 5: 117,809,523 (GRCm39) C429R probably damaging Het
Loxhd1 A C 18: 77,476,095 (GRCm39) I1121L possibly damaging Het
Map2 T C 1: 66,453,902 (GRCm39) F931L probably benign Het
Mepce T C 5: 137,782,935 (GRCm39) I464V probably benign Het
Mpo G T 11: 87,692,475 (GRCm39) V538L probably benign Het
Mtarc2 T A 1: 184,573,509 (GRCm39) M130L possibly damaging Het
Mtrex T A 13: 113,009,517 (GRCm39) K961* probably null Het
Myom1 T C 17: 71,391,290 (GRCm39) V933A probably damaging Het
Nckap1l T G 15: 103,386,957 (GRCm39) probably null Het
Ncmap C A 4: 135,104,375 (GRCm39) M19I possibly damaging Het
Neb T A 2: 52,073,848 (GRCm39) I5920F probably benign Het
Nnt C T 13: 119,511,212 (GRCm39) V355I probably benign Het
Nr1i2 C T 16: 38,073,326 (GRCm39) G217S probably damaging Het
Nsd1 A G 13: 55,458,180 (GRCm39) R2098G possibly damaging Het
Parp4 A G 14: 56,884,703 (GRCm39) T1261A probably benign Het
Pcgf3 A T 5: 108,635,723 (GRCm39) N131I probably benign Het
Plcb2 C T 2: 118,541,302 (GRCm39) D1012N probably benign Het
Plcl2 T C 17: 50,914,689 (GRCm39) I566T probably damaging Het
Plekha1 G A 7: 130,510,102 (GRCm39) A283T probably damaging Het
Prag1 A T 8: 36,567,079 (GRCm39) M77L possibly damaging Het
Rhbdl2 A T 4: 123,718,711 (GRCm39) I222L probably benign Het
Rnh1 A C 7: 140,740,617 (GRCm39) V446G probably damaging Het
Sash1 C T 10: 8,626,805 (GRCm39) R193H possibly damaging Het
Sgf29 G T 7: 126,271,826 (GRCm39) V284L possibly damaging Het
Slc12a3 G A 8: 95,057,012 (GRCm39) G95D probably benign Het
Slc17a7 T C 7: 44,819,714 (GRCm39) V172A probably damaging Het
Spta1 T C 1: 174,045,510 (GRCm39) V1556A probably benign Het
Ttn T C 2: 76,673,132 (GRCm39) E11224G unknown Het
Wipf1 G A 2: 73,267,879 (GRCm39) P173L possibly damaging Het
Zdbf2 C T 1: 63,345,572 (GRCm39) T1317I possibly damaging Het
Zfat C T 15: 67,973,355 (GRCm39) A1147T probably benign Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zhx3 T G 2: 160,622,695 (GRCm39) I491L probably benign Het
Zranb3 T C 1: 127,882,732 (GRCm39) D1061G probably damaging Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 34,065,339 (GRCm39) missense probably benign 0.18
IGL00705:Tex15 APN 8 34,071,620 (GRCm39) missense probably damaging 1.00
IGL00820:Tex15 APN 8 34,069,034 (GRCm39) splice site probably benign
IGL01288:Tex15 APN 8 34,061,412 (GRCm39) missense probably benign 0.02
IGL01328:Tex15 APN 8 34,061,424 (GRCm39) nonsense probably null
IGL01359:Tex15 APN 8 34,071,926 (GRCm39) missense probably damaging 0.99
IGL01603:Tex15 APN 8 34,063,575 (GRCm39) missense possibly damaging 0.93
IGL01861:Tex15 APN 8 34,060,717 (GRCm39) missense probably damaging 1.00
IGL02052:Tex15 APN 8 34,072,493 (GRCm39) missense probably benign 0.28
IGL02560:Tex15 APN 8 34,071,779 (GRCm39) missense probably benign 0.00
IGL02677:Tex15 APN 8 34,061,108 (GRCm39) missense probably benign 0.03
IGL02739:Tex15 APN 8 34,071,721 (GRCm39) missense possibly damaging 0.68
Big_gulp UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
P0005:Tex15 UTSW 8 34,060,896 (GRCm39) missense probably benign 0.00
P0037:Tex15 UTSW 8 34,071,608 (GRCm39) missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 34,061,129 (GRCm39) missense probably damaging 1.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0595:Tex15 UTSW 8 34,062,645 (GRCm39) missense probably damaging 1.00
R0646:Tex15 UTSW 8 34,072,354 (GRCm39) missense possibly damaging 0.83
R0688:Tex15 UTSW 8 34,063,528 (GRCm39) missense probably damaging 1.00
R0842:Tex15 UTSW 8 34,061,575 (GRCm39) missense possibly damaging 0.95
R0987:Tex15 UTSW 8 34,066,875 (GRCm39) missense probably damaging 1.00
R1084:Tex15 UTSW 8 34,067,032 (GRCm39) missense probably benign 0.28
R1183:Tex15 UTSW 8 34,064,893 (GRCm39) missense probably benign 0.35
R1186:Tex15 UTSW 8 34,061,661 (GRCm39) missense probably benign 0.19
R1378:Tex15 UTSW 8 34,065,244 (GRCm39) missense probably damaging 0.99
R1500:Tex15 UTSW 8 34,065,120 (GRCm39) missense probably damaging 0.96
R1508:Tex15 UTSW 8 34,066,880 (GRCm39) missense probably damaging 1.00
R1597:Tex15 UTSW 8 34,061,511 (GRCm39) missense probably damaging 0.96
R1636:Tex15 UTSW 8 34,066,415 (GRCm39) nonsense probably null
R1639:Tex15 UTSW 8 34,060,845 (GRCm39) missense possibly damaging 0.94
R1809:Tex15 UTSW 8 34,064,262 (GRCm39) missense probably benign
R1843:Tex15 UTSW 8 34,066,682 (GRCm39) missense probably benign 0.27
R2029:Tex15 UTSW 8 34,061,302 (GRCm39) missense probably damaging 0.99
R2228:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2229:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2245:Tex15 UTSW 8 34,061,524 (GRCm39) missense possibly damaging 0.77
R2246:Tex15 UTSW 8 34,072,540 (GRCm39) missense possibly damaging 0.49
R2880:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2881:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2882:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R3001:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3002:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3020:Tex15 UTSW 8 34,066,698 (GRCm39) missense probably damaging 1.00
R3084:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3085:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3701:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3702:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3752:Tex15 UTSW 8 34,061,443 (GRCm39) missense probably benign
R4162:Tex15 UTSW 8 34,071,586 (GRCm39) missense probably damaging 1.00
R4231:Tex15 UTSW 8 34,062,165 (GRCm39) missense probably damaging 0.99
R4589:Tex15 UTSW 8 34,047,401 (GRCm39) missense probably damaging 1.00
R4707:Tex15 UTSW 8 34,072,525 (GRCm39) missense probably benign 0.00
R4773:Tex15 UTSW 8 34,072,760 (GRCm39) missense probably benign 0.42
R4967:Tex15 UTSW 8 34,064,498 (GRCm39) missense probably benign 0.34
R5063:Tex15 UTSW 8 34,072,638 (GRCm39) missense possibly damaging 0.59
R5121:Tex15 UTSW 8 34,061,794 (GRCm39) missense probably damaging 1.00
R5147:Tex15 UTSW 8 34,062,340 (GRCm39) nonsense probably null
R5166:Tex15 UTSW 8 34,066,420 (GRCm39) missense probably benign 0.07
R5173:Tex15 UTSW 8 34,061,768 (GRCm39) missense possibly damaging 0.73
R5439:Tex15 UTSW 8 34,064,199 (GRCm39) missense possibly damaging 0.93
R5537:Tex15 UTSW 8 34,061,641 (GRCm39) missense probably damaging 1.00
R5580:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R5588:Tex15 UTSW 8 34,067,215 (GRCm39) missense probably damaging 1.00
R5696:Tex15 UTSW 8 34,063,220 (GRCm39) missense probably benign 0.01
R5734:Tex15 UTSW 8 34,036,364 (GRCm39) missense probably benign 0.01
R5756:Tex15 UTSW 8 34,065,861 (GRCm39) missense probably benign 0.17
R5823:Tex15 UTSW 8 34,060,962 (GRCm39) missense possibly damaging 0.67
R6126:Tex15 UTSW 8 34,063,591 (GRCm39) missense probably benign 0.19
R6129:Tex15 UTSW 8 34,064,158 (GRCm39) missense possibly damaging 0.90
R6276:Tex15 UTSW 8 34,067,217 (GRCm39) missense possibly damaging 0.93
R6374:Tex15 UTSW 8 34,065,940 (GRCm39) missense probably damaging 1.00
R6430:Tex15 UTSW 8 34,061,329 (GRCm39) missense probably benign 0.01
R6452:Tex15 UTSW 8 34,062,844 (GRCm39) missense probably damaging 1.00
R6471:Tex15 UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
R6700:Tex15 UTSW 8 34,064,917 (GRCm39) missense possibly damaging 0.93
R6918:Tex15 UTSW 8 34,063,212 (GRCm39) missense probably benign 0.27
R6958:Tex15 UTSW 8 34,060,899 (GRCm39) missense probably benign 0.01
R6970:Tex15 UTSW 8 34,047,456 (GRCm39) missense probably benign 0.03
R7059:Tex15 UTSW 8 34,064,758 (GRCm39) missense possibly damaging 0.57
R7069:Tex15 UTSW 8 34,060,748 (GRCm39) missense probably benign
R7072:Tex15 UTSW 8 34,065,459 (GRCm39) missense possibly damaging 0.85
R7212:Tex15 UTSW 8 34,063,023 (GRCm39) missense probably damaging 1.00
R7212:Tex15 UTSW 8 34,060,854 (GRCm39) nonsense probably null
R7216:Tex15 UTSW 8 34,063,014 (GRCm39) missense possibly damaging 0.93
R7219:Tex15 UTSW 8 34,036,268 (GRCm39) missense probably benign 0.40
R7313:Tex15 UTSW 8 34,064,845 (GRCm39) missense possibly damaging 0.82
R7315:Tex15 UTSW 8 34,071,544 (GRCm39) missense probably benign 0.01
R7444:Tex15 UTSW 8 34,066,590 (GRCm39) missense possibly damaging 0.92
R7455:Tex15 UTSW 8 34,067,025 (GRCm39) missense possibly damaging 0.91
R7643:Tex15 UTSW 8 34,065,148 (GRCm39) missense probably damaging 1.00
R7644:Tex15 UTSW 8 34,064,445 (GRCm39) missense probably benign 0.01
R7724:Tex15 UTSW 8 34,036,291 (GRCm39) missense possibly damaging 0.60
R7779:Tex15 UTSW 8 34,065,309 (GRCm39) missense probably damaging 1.00
R7798:Tex15 UTSW 8 34,071,875 (GRCm39) missense possibly damaging 0.69
R7816:Tex15 UTSW 8 34,071,683 (GRCm39) missense probably benign 0.14
R7820:Tex15 UTSW 8 34,065,090 (GRCm39) missense probably damaging 0.98
R8041:Tex15 UTSW 8 34,065,874 (GRCm39) missense probably damaging 1.00
R8150:Tex15 UTSW 8 34,063,534 (GRCm39) missense probably benign 0.06
R8237:Tex15 UTSW 8 34,067,427 (GRCm39) missense possibly damaging 0.72
R8250:Tex15 UTSW 8 34,055,233 (GRCm39) missense probably null 0.27
R8264:Tex15 UTSW 8 34,072,390 (GRCm39) missense probably benign 0.18
R8279:Tex15 UTSW 8 34,061,765 (GRCm39) missense probably damaging 0.96
R8353:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8388:Tex15 UTSW 8 34,065,237 (GRCm39) missense probably benign 0.00
R8432:Tex15 UTSW 8 34,066,572 (GRCm39) missense probably damaging 0.99
R8453:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8489:Tex15 UTSW 8 34,067,574 (GRCm39) missense probably benign 0.02
R8670:Tex15 UTSW 8 34,064,746 (GRCm39) missense probably benign 0.19
R8703:Tex15 UTSW 8 34,062,724 (GRCm39) missense probably benign 0.00
R8871:Tex15 UTSW 8 34,066,992 (GRCm39) missense possibly damaging 0.62
R8945:Tex15 UTSW 8 34,064,724 (GRCm39) missense probably benign 0.00
R9104:Tex15 UTSW 8 34,060,950 (GRCm39) missense possibly damaging 0.86
R9132:Tex15 UTSW 8 34,067,554 (GRCm39) missense possibly damaging 0.84
R9207:Tex15 UTSW 8 34,065,784 (GRCm39) missense probably damaging 1.00
R9210:Tex15 UTSW 8 34,064,319 (GRCm39) missense possibly damaging 0.91
R9330:Tex15 UTSW 8 34,065,143 (GRCm39) missense probably benign 0.01
R9354:Tex15 UTSW 8 34,063,344 (GRCm39) missense possibly damaging 0.86
R9365:Tex15 UTSW 8 34,064,564 (GRCm39) missense possibly damaging 0.56
R9440:Tex15 UTSW 8 34,072,273 (GRCm39) missense possibly damaging 0.90
R9534:Tex15 UTSW 8 34,060,999 (GRCm39) missense probably benign 0.45
R9570:Tex15 UTSW 8 34,067,309 (GRCm39) missense probably damaging 0.96
R9574:Tex15 UTSW 8 34,064,509 (GRCm39) missense probably benign 0.09
R9618:Tex15 UTSW 8 34,062,397 (GRCm39) missense probably benign 0.35
R9655:Tex15 UTSW 8 34,066,784 (GRCm39) nonsense probably null
R9786:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R9798:Tex15 UTSW 8 34,062,721 (GRCm39) missense probably damaging 0.98
RF005:Tex15 UTSW 8 34,066,705 (GRCm39) missense probably benign 0.05
X0020:Tex15 UTSW 8 34,066,607 (GRCm39) missense probably benign 0.03
X0065:Tex15 UTSW 8 34,065,545 (GRCm39) nonsense probably null
Z1088:Tex15 UTSW 8 34,061,343 (GRCm39) missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 34,064,898 (GRCm39) missense probably benign
Z1088:Tex15 UTSW 8 34,061,838 (GRCm39) missense possibly damaging 0.68
Z1176:Tex15 UTSW 8 34,064,754 (GRCm39) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ATAGTTGGCACTACTGTCCTTAC -3'
(R):5'- ATGCTGATCAGTACCCTCCC -3'

Sequencing Primer
(F):5'- CCTTACAGTAAGCACAAGTCTTGGG -3'
(R):5'- CCCTTCTTGCAAAACTTGAGG -3'
Posted On 2020-06-30