Incidental Mutation 'R8152:Tex15'
ID 633016
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Name testis expressed gene 15
Synonyms 2210014E14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock # R8152 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 33516738-33585582 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 33572893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 784 (E784K)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000009772
AA Change: E784K

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: E784K

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124496
AA Change: E1058K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: E1058K

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 92.4%
Validation Efficiency 99% (74/75)
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,458 L195P probably damaging Het
Adgrb1 T C 15: 74,541,611 V548A probably benign Het
Adgrb1 T C 15: 74,545,000 I752T probably damaging Het
Adgrb3 T C 1: 25,221,757 probably null Het
Adh6a G T 3: 138,327,514 probably null Het
Aldh18a1 A G 19: 40,565,012 S431P probably benign Het
Arap3 T C 18: 37,991,357 R310G possibly damaging Het
Atad5 T C 11: 80,095,170 V361A possibly damaging Het
Atp8a1 C A 5: 67,762,582 M380I Het
Calcrl C T 2: 84,339,249 V363M possibly damaging Het
Camsap1 G T 2: 25,940,241 D490E probably damaging Het
Cd72 T A 4: 43,452,601 I131F possibly damaging Het
Cdh2 C T 18: 16,629,519 G513D probably benign Het
Cela1 T C 15: 100,682,941 T145A probably benign Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfap99 C T 5: 34,323,391 R462C probably damaging Het
Cmtm1 A G 8: 104,309,941 S19P possibly damaging Het
Crebbp A T 16: 4,085,081 M2098K possibly damaging Het
Csmd3 T C 15: 47,669,464 probably null Het
Ctsm C G 13: 61,539,649 V100L probably benign Het
Cyp2c67 C A 19: 39,640,008 C164F probably benign Het
Cyp2d11 T C 15: 82,392,487 I84V probably benign Het
Cyp2j11 T C 4: 96,307,292 D389G probably damaging Het
Dctd A G 8: 48,111,690 D9G probably benign Het
Fam221a C A 6: 49,378,556 F197L probably damaging Het
Fbxl4 T G 4: 22,427,225 C489G possibly damaging Het
Fmn1 C T 2: 113,365,692 T579M unknown Het
Fndc3a G A 14: 72,574,380 L337F probably damaging Het
Frmpd2 A G 14: 33,543,287 probably null Het
Gdnf C T 15: 7,834,762 S218L probably damaging Het
Gen1 A G 12: 11,243,265 F444L probably damaging Het
Gk5 A T 9: 96,174,703 D391V probably damaging Het
Gys2 T C 6: 142,427,410 T612A probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Isx T C 8: 74,889,999 F85L probably damaging Het
Kcnh5 T C 12: 74,897,859 D872G possibly damaging Het
Kif26b T G 1: 178,679,229 V290G possibly damaging Het
Ksr2 T C 5: 117,671,458 C429R probably damaging Het
Loxhd1 A C 18: 77,388,399 I1121L possibly damaging Het
Map2 T C 1: 66,414,743 F931L probably benign Het
Marc2 T A 1: 184,841,312 M130L possibly damaging Het
Mepce T C 5: 137,784,673 I464V probably benign Het
Mpo G T 11: 87,801,649 V538L probably benign Het
Myom1 T C 17: 71,084,295 V933A probably damaging Het
Nckap1l T G 15: 103,478,530 probably null Het
Ncmap C A 4: 135,377,064 M19I possibly damaging Het
Neb T A 2: 52,183,836 I5920F probably benign Het
Nnt C T 13: 119,374,676 V355I probably benign Het
Nr1i2 C T 16: 38,252,964 G217S probably damaging Het
Nsd1 A G 13: 55,310,367 R2098G possibly damaging Het
Parp4 A G 14: 56,647,246 T1261A probably benign Het
Pcgf3 A T 5: 108,487,857 N131I probably benign Het
Plcb2 C T 2: 118,710,821 D1012N probably benign Het
Plcl2 T C 17: 50,607,661 I566T probably damaging Het
Plekha1 G A 7: 130,908,372 A283T probably damaging Het
Prag1 A T 8: 36,099,925 M77L possibly damaging Het
Rhbdl2 A T 4: 123,824,918 I222L probably benign Het
Rnh1 A C 7: 141,160,704 V446G probably damaging Het
Sash1 C T 10: 8,751,041 R193H possibly damaging Het
Sgf29 G T 7: 126,672,654 V284L possibly damaging Het
Skiv2l2 T A 13: 112,872,983 K961* probably null Het
Slc12a3 G A 8: 94,330,384 G95D probably benign Het
Slc17a7 T C 7: 45,170,290 V172A probably damaging Het
Spta1 T C 1: 174,217,944 V1556A probably benign Het
Ttn T C 2: 76,842,788 E11224G unknown Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zdbf2 C T 1: 63,306,413 T1317I possibly damaging Het
Zfat C T 15: 68,101,506 A1147T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zhx3 T G 2: 160,780,775 I491L probably benign Het
Zranb3 T C 1: 127,954,995 D1061G probably damaging Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
Big_gulp UTSW 8 33581734 missense probably damaging 1.00
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 33571101 missense probably damaging 1.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0842:Tex15 UTSW 8 33571547 missense possibly damaging 0.95
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1639:Tex15 UTSW 8 33570817 missense possibly damaging 0.94
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R4967:Tex15 UTSW 8 33574470 missense probably benign 0.34
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6276:Tex15 UTSW 8 33577189 missense possibly damaging 0.93
R6374:Tex15 UTSW 8 33575912 missense probably damaging 1.00
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
R7059:Tex15 UTSW 8 33574730 missense possibly damaging 0.57
R7069:Tex15 UTSW 8 33570720 missense probably benign
R7072:Tex15 UTSW 8 33575431 missense possibly damaging 0.85
R7212:Tex15 UTSW 8 33570826 nonsense probably null
R7212:Tex15 UTSW 8 33572995 missense probably damaging 1.00
R7216:Tex15 UTSW 8 33572986 missense possibly damaging 0.93
R7219:Tex15 UTSW 8 33546240 missense probably benign 0.40
R7313:Tex15 UTSW 8 33574817 missense possibly damaging 0.82
R7315:Tex15 UTSW 8 33581516 missense probably benign 0.01
R7444:Tex15 UTSW 8 33576562 missense possibly damaging 0.92
R7455:Tex15 UTSW 8 33576997 missense possibly damaging 0.91
R7643:Tex15 UTSW 8 33575120 missense probably damaging 1.00
R7644:Tex15 UTSW 8 33574417 missense probably benign 0.01
R7724:Tex15 UTSW 8 33546263 missense possibly damaging 0.60
R7779:Tex15 UTSW 8 33575281 missense probably damaging 1.00
R7798:Tex15 UTSW 8 33581847 missense possibly damaging 0.69
R7816:Tex15 UTSW 8 33581655 missense probably benign 0.14
R7820:Tex15 UTSW 8 33575062 missense probably damaging 0.98
R8041:Tex15 UTSW 8 33575846 missense probably damaging 1.00
R8150:Tex15 UTSW 8 33573506 missense probably benign 0.06
R8237:Tex15 UTSW 8 33577399 missense possibly damaging 0.72
R8250:Tex15 UTSW 8 33565205 missense probably null 0.27
R8264:Tex15 UTSW 8 33582362 missense probably benign 0.18
R8279:Tex15 UTSW 8 33571737 missense probably damaging 0.96
R8353:Tex15 UTSW 8 33576871 nonsense probably null
R8388:Tex15 UTSW 8 33575209 missense probably benign 0.00
R8432:Tex15 UTSW 8 33576544 missense probably damaging 0.99
R8453:Tex15 UTSW 8 33576871 nonsense probably null
R8489:Tex15 UTSW 8 33577546 missense probably benign 0.02
R8670:Tex15 UTSW 8 33574718 missense probably benign 0.19
R8703:Tex15 UTSW 8 33572696 missense probably benign 0.00
R8871:Tex15 UTSW 8 33576964 missense possibly damaging 0.62
R8945:Tex15 UTSW 8 33574696 missense probably benign 0.00
R9104:Tex15 UTSW 8 33570922 missense possibly damaging 0.86
R9132:Tex15 UTSW 8 33577526 missense possibly damaging 0.84
R9207:Tex15 UTSW 8 33575756 missense probably damaging 1.00
R9210:Tex15 UTSW 8 33574291 missense possibly damaging 0.91
R9330:Tex15 UTSW 8 33575115 missense probably benign 0.01
R9354:Tex15 UTSW 8 33573316 missense possibly damaging 0.86
R9365:Tex15 UTSW 8 33574536 missense possibly damaging 0.56
R9440:Tex15 UTSW 8 33582245 missense possibly damaging 0.90
R9534:Tex15 UTSW 8 33570971 missense probably benign 0.45
R9570:Tex15 UTSW 8 33577281 missense probably damaging 0.96
R9574:Tex15 UTSW 8 33574481 missense probably benign 0.09
R9618:Tex15 UTSW 8 33572369 missense probably benign 0.35
R9655:Tex15 UTSW 8 33576756 nonsense probably null
R9786:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R9798:Tex15 UTSW 8 33572693 missense probably damaging 0.98
RF005:Tex15 UTSW 8 33576677 missense probably benign 0.05
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Z1176:Tex15 UTSW 8 33574726 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ATAGTTGGCACTACTGTCCTTAC -3'
(R):5'- ATGCTGATCAGTACCCTCCC -3'

Sequencing Primer
(F):5'- CCTTACAGTAAGCACAAGTCTTGGG -3'
(R):5'- CCCTTCTTGCAAAACTTGAGG -3'
Posted On 2020-06-30