Mutagenetix > Incidental Mutation

Incidental Mutation 'R8152:Tex15'

633016

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R8152 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 33572893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 784 (E784K)

Ref Sequence

ENSEMBL: ENSMUSP00000009772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000009772
AA Change: E784K

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: E784K

Domain	Start	End	E-Value	Type
low complexity region	262	274	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	524	536	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	713	725	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1497	1508	N/A	INTRINSIC
Pfam:TEX15	1572	1788	1.3e-109	PFAM
Pfam:TEX15	1901	2119	1.1e-16	PFAM
low complexity region	2758	2770	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124496
AA Change: E1058K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: E1058K

Domain	Start	End	E-Value	Type
Pfam:DUF3715	89	251	1.6e-58	PFAM
low complexity region	536	548	N/A	INTRINSIC
low complexity region	576	587	N/A	INTRINSIC
low complexity region	798	810	N/A	INTRINSIC
low complexity region	939	948	N/A	INTRINSIC
low complexity region	987	999	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.3%
20x: 92.4%

Validation Efficiency

99% (74/75)

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,896,458	L195P	probably damaging	Het
Adgrb1	T	C	15: 74,541,611	V548A	probably benign	Het
Adgrb1	T	C	15: 74,545,000	I752T	probably damaging	Het
Adgrb3	T	C	1: 25,221,757		probably null	Het
Adh6a	G	T	3: 138,327,514		probably null	Het
Aldh18a1	A	G	19: 40,565,012	S431P	probably benign	Het
Arap3	T	C	18: 37,991,357	R310G	possibly damaging	Het
Atad5	T	C	11: 80,095,170	V361A	possibly damaging	Het
Atp8a1	C	A	5: 67,762,582	M380I		Het
Calcrl	C	T	2: 84,339,249	V363M	possibly damaging	Het
Camsap1	G	T	2: 25,940,241	D490E	probably damaging	Het
Cd72	T	A	4: 43,452,601	I131F	possibly damaging	Het
Cdh2	C	T	18: 16,629,519	G513D	probably benign	Het
Cela1	T	C	15: 100,682,941	T145A	probably benign	Het
Cep250	A	G	2: 155,969,307	T358A	probably benign	Het
Cfap99	C	T	5: 34,323,391	R462C	probably damaging	Het
Cmtm1	A	G	8: 104,309,941	S19P	possibly damaging	Het
Crebbp	A	T	16: 4,085,081	M2098K	possibly damaging	Het
Csmd3	T	C	15: 47,669,464		probably null	Het
Ctsm	C	G	13: 61,539,649	V100L	probably benign	Het
Cyp2c67	C	A	19: 39,640,008	C164F	probably benign	Het
Cyp2d11	T	C	15: 82,392,487	I84V	probably benign	Het
Cyp2j11	T	C	4: 96,307,292	D389G	probably damaging	Het
Dctd	A	G	8: 48,111,690	D9G	probably benign	Het
Fam221a	C	A	6: 49,378,556	F197L	probably damaging	Het
Fbxl4	T	G	4: 22,427,225	C489G	possibly damaging	Het
Fmn1	C	T	2: 113,365,692	T579M	unknown	Het
Fndc3a	G	A	14: 72,574,380	L337F	probably damaging	Het
Frmpd2	A	G	14: 33,543,287		probably null	Het
Gdnf	C	T	15: 7,834,762	S218L	probably damaging	Het
Gen1	A	G	12: 11,243,265	F444L	probably damaging	Het
Gk5	A	T	9: 96,174,703	D391V	probably damaging	Het
Gys2	T	C	6: 142,427,410	T612A	probably benign	Het
Il17ra	A	G	6: 120,482,102	D738G	probably benign	Het
Isx	T	C	8: 74,889,999	F85L	probably damaging	Het
Kcnh5	T	C	12: 74,897,859	D872G	possibly damaging	Het
Kif26b	T	G	1: 178,679,229	V290G	possibly damaging	Het
Ksr2	T	C	5: 117,671,458	C429R	probably damaging	Het
Loxhd1	A	C	18: 77,388,399	I1121L	possibly damaging	Het
Map2	T	C	1: 66,414,743	F931L	probably benign	Het
Marc2	T	A	1: 184,841,312	M130L	possibly damaging	Het
Mepce	T	C	5: 137,784,673	I464V	probably benign	Het
Mpo	G	T	11: 87,801,649	V538L	probably benign	Het
Myom1	T	C	17: 71,084,295	V933A	probably damaging	Het
Nckap1l	T	G	15: 103,478,530		probably null	Het
Ncmap	C	A	4: 135,377,064	M19I	possibly damaging	Het
Neb	T	A	2: 52,183,836	I5920F	probably benign	Het
Nnt	C	T	13: 119,374,676	V355I	probably benign	Het
Nr1i2	C	T	16: 38,252,964	G217S	probably damaging	Het
Nsd1	A	G	13: 55,310,367	R2098G	possibly damaging	Het
Parp4	A	G	14: 56,647,246	T1261A	probably benign	Het
Pcgf3	A	T	5: 108,487,857	N131I	probably benign	Het
Plcb2	C	T	2: 118,710,821	D1012N	probably benign	Het
Plcl2	T	C	17: 50,607,661	I566T	probably damaging	Het
Plekha1	G	A	7: 130,908,372	A283T	probably damaging	Het
Prag1	A	T	8: 36,099,925	M77L	possibly damaging	Het
Rhbdl2	A	T	4: 123,824,918	I222L	probably benign	Het
Rnh1	A	C	7: 141,160,704	V446G	probably damaging	Het
Sash1	C	T	10: 8,751,041	R193H	possibly damaging	Het
Sgf29	G	T	7: 126,672,654	V284L	possibly damaging	Het
Skiv2l2	T	A	13: 112,872,983	K961*	probably null	Het
Slc12a3	G	A	8: 94,330,384	G95D	probably benign	Het
Slc17a7	T	C	7: 45,170,290	V172A	probably damaging	Het
Spta1	T	C	1: 174,217,944	V1556A	probably benign	Het
Ttn	T	C	2: 76,842,788	E11224G	unknown	Het
Wipf1	G	A	2: 73,437,535	P173L	possibly damaging	Het
Zdbf2	C	T	1: 63,306,413	T1317I	possibly damaging	Het
Zfat	C	T	15: 68,101,506	A1147T	probably benign	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zhx3	T	G	2: 160,780,775	I491L	probably benign	Het
Zranb3	T	C	1: 127,954,995	D1061G	probably damaging	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1186:Tex15	UTSW	8	33571633	missense	probably benign	0.19
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2229:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4231:Tex15	UTSW	8	33572137	missense	probably damaging	0.99
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6276:Tex15	UTSW	8	33577189	missense	possibly damaging	0.93
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R6970:Tex15	UTSW	8	33557428	missense	probably benign	0.03
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7315:Tex15	UTSW	8	33581516	missense	probably benign	0.01
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
R8670:Tex15	UTSW	8	33574718	missense	probably benign	0.19
R8703:Tex15	UTSW	8	33572696	missense	probably benign	0.00
R8871:Tex15	UTSW	8	33576964	missense	possibly damaging	0.62
R8945:Tex15	UTSW	8	33574696	missense	probably benign	0.00
R9104:Tex15	UTSW	8	33570922	missense	possibly damaging	0.86
R9132:Tex15	UTSW	8	33577526	missense	possibly damaging	0.84
R9207:Tex15	UTSW	8	33575756	missense	probably damaging	1.00
R9210:Tex15	UTSW	8	33574291	missense	possibly damaging	0.91
R9330:Tex15	UTSW	8	33575115	missense	probably benign	0.01
R9354:Tex15	UTSW	8	33573316	missense	possibly damaging	0.86
R9365:Tex15	UTSW	8	33574536	missense	possibly damaging	0.56
R9440:Tex15	UTSW	8	33582245	missense	possibly damaging	0.90
R9534:Tex15	UTSW	8	33570971	missense	probably benign	0.45
R9570:Tex15	UTSW	8	33577281	missense	probably damaging	0.96
R9574:Tex15	UTSW	8	33574481	missense	probably benign	0.09
R9618:Tex15	UTSW	8	33572369	missense	probably benign	0.35
R9655:Tex15	UTSW	8	33576756	nonsense	probably null
R9786:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R9798:Tex15	UTSW	8	33572693	missense	probably damaging	0.98
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- ATAGTTGGCACTACTGTCCTTAC -3'
(R):5'- ATGCTGATCAGTACCCTCCC -3'

Sequencing Primer
(F):5'- CCTTACAGTAAGCACAAGTCTTGGG -3'
(R):5'- CCCTTCTTGCAAAACTTGAGG -3'

Posted On

2020-06-30