Incidental Mutation 'R8152:Dctd'
ID 633018
Institutional Source Beutler Lab
Gene Symbol Dctd
Ensembl Gene ENSMUSG00000031562
Gene Name dCMP deaminase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8152 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 48099092-48153233 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48111690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 9 (D9G)
Ref Sequence ENSEMBL: ENSMUSP00000033966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033966] [ENSMUST00000170263] [ENSMUST00000174278] [ENSMUST00000174379] [ENSMUST00000174818]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033966
AA Change: D9G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033966
Gene: ENSMUSG00000031562
AA Change: D9G

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170263
AA Change: D9G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126733
Gene: ENSMUSG00000031562
AA Change: D9G

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174278
AA Change: D9G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133445
Gene: ENSMUSG00000031562
AA Change: D9G

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174379
AA Change: D9G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134195
Gene: ENSMUSG00000031562
AA Change: D9G

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 103 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174818
AA Change: D9G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134003
Gene: ENSMUSG00000031562
AA Change: D9G

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 131 1.5e-27 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 92.4%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the deamination of dCMP to dUMP, the nucleotide substrate for thymidylate synthase. The encoded protein is allosterically activated by dCTP and inhibited by dTTP, and is found as a homohexamer. This protein uses zinc as a cofactor for its activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,458 L195P probably damaging Het
Adgrb1 T C 15: 74,541,611 V548A probably benign Het
Adgrb1 T C 15: 74,545,000 I752T probably damaging Het
Adgrb3 T C 1: 25,221,757 probably null Het
Adh6a G T 3: 138,327,514 probably null Het
Aldh18a1 A G 19: 40,565,012 S431P probably benign Het
Arap3 T C 18: 37,991,357 R310G possibly damaging Het
Atad5 T C 11: 80,095,170 V361A possibly damaging Het
Atp8a1 C A 5: 67,762,582 M380I Het
Calcrl C T 2: 84,339,249 V363M possibly damaging Het
Camsap1 G T 2: 25,940,241 D490E probably damaging Het
Cd72 T A 4: 43,452,601 I131F possibly damaging Het
Cdh2 C T 18: 16,629,519 G513D probably benign Het
Cela1 T C 15: 100,682,941 T145A probably benign Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfap99 C T 5: 34,323,391 R462C probably damaging Het
Cmtm1 A G 8: 104,309,941 S19P possibly damaging Het
Crebbp A T 16: 4,085,081 M2098K possibly damaging Het
Csmd3 T C 15: 47,669,464 probably null Het
Ctsm C G 13: 61,539,649 V100L probably benign Het
Cyp2c67 C A 19: 39,640,008 C164F probably benign Het
Cyp2d11 T C 15: 82,392,487 I84V probably benign Het
Cyp2j11 T C 4: 96,307,292 D389G probably damaging Het
Fam221a C A 6: 49,378,556 F197L probably damaging Het
Fbxl4 T G 4: 22,427,225 C489G possibly damaging Het
Fmn1 C T 2: 113,365,692 T579M unknown Het
Fndc3a G A 14: 72,574,380 L337F probably damaging Het
Frmpd2 A G 14: 33,543,287 probably null Het
Gdnf C T 15: 7,834,762 S218L probably damaging Het
Gen1 A G 12: 11,243,265 F444L probably damaging Het
Gk5 A T 9: 96,174,703 D391V probably damaging Het
Gys2 T C 6: 142,427,410 T612A probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Isx T C 8: 74,889,999 F85L probably damaging Het
Kcnh5 T C 12: 74,897,859 D872G possibly damaging Het
Kif26b T G 1: 178,679,229 V290G possibly damaging Het
Ksr2 T C 5: 117,671,458 C429R probably damaging Het
Loxhd1 A C 18: 77,388,399 I1121L possibly damaging Het
Map2 T C 1: 66,414,743 F931L probably benign Het
Marc2 T A 1: 184,841,312 M130L possibly damaging Het
Mepce T C 5: 137,784,673 I464V probably benign Het
Mpo G T 11: 87,801,649 V538L probably benign Het
Myom1 T C 17: 71,084,295 V933A probably damaging Het
Nckap1l T G 15: 103,478,530 probably null Het
Ncmap C A 4: 135,377,064 M19I possibly damaging Het
Neb T A 2: 52,183,836 I5920F probably benign Het
Nnt C T 13: 119,374,676 V355I probably benign Het
Nr1i2 C T 16: 38,252,964 G217S probably damaging Het
Nsd1 A G 13: 55,310,367 R2098G possibly damaging Het
Parp4 A G 14: 56,647,246 T1261A probably benign Het
Pcgf3 A T 5: 108,487,857 N131I probably benign Het
Plcb2 C T 2: 118,710,821 D1012N probably benign Het
Plcl2 T C 17: 50,607,661 I566T probably damaging Het
Plekha1 G A 7: 130,908,372 A283T probably damaging Het
Prag1 A T 8: 36,099,925 M77L possibly damaging Het
Rhbdl2 A T 4: 123,824,918 I222L probably benign Het
Rnh1 A C 7: 141,160,704 V446G probably damaging Het
Sash1 C T 10: 8,751,041 R193H possibly damaging Het
Sgf29 G T 7: 126,672,654 V284L possibly damaging Het
Skiv2l2 T A 13: 112,872,983 K961* probably null Het
Slc12a3 G A 8: 94,330,384 G95D probably benign Het
Slc17a7 T C 7: 45,170,290 V172A probably damaging Het
Spta1 T C 1: 174,217,944 V1556A probably benign Het
Tex15 G A 8: 33,572,893 E784K possibly damaging Het
Ttn T C 2: 76,842,788 E11224G unknown Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zdbf2 C T 1: 63,306,413 T1317I possibly damaging Het
Zfat C T 15: 68,101,506 A1147T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zhx3 T G 2: 160,780,775 I491L probably benign Het
Zranb3 T C 1: 127,954,995 D1061G probably damaging Het
Other mutations in Dctd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Dctd APN 8 48111662 start gained probably benign
R0194:Dctd UTSW 8 48112078 missense probably benign 0.01
R4871:Dctd UTSW 8 48137414 intron probably benign
R5007:Dctd UTSW 8 48137414 intron probably benign
R5008:Dctd UTSW 8 48137414 intron probably benign
R5009:Dctd UTSW 8 48137414 intron probably benign
R5010:Dctd UTSW 8 48137414 intron probably benign
R5083:Dctd UTSW 8 48111716 missense probably damaging 1.00
R5381:Dctd UTSW 8 48137414 intron probably benign
R5382:Dctd UTSW 8 48137414 intron probably benign
R7131:Dctd UTSW 8 48112040 missense probably benign 0.02
R8693:Dctd UTSW 8 48112011 missense probably damaging 1.00
R8739:Dctd UTSW 8 48138848 missense probably benign 0.00
R9009:Dctd UTSW 8 48111677 missense probably benign
R9408:Dctd UTSW 8 48137350 missense probably damaging 1.00
X0057:Dctd UTSW 8 48140360 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGGATGCTCTCTTTGAAGTC -3'
(R):5'- TGAATAGCTGGGAAGTCACTGG -3'

Sequencing Primer
(F):5'- CTCTCTTTGAAGTCTAGGGCTCATG -3'
(R):5'- GGAGTTCTGAGTTGCCAAACTATCC -3'
Posted On 2020-06-30