Incidental Mutation 'R8152:Gen1'
ID633026
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8152 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11243265 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 444 (F444L)
Ref Sequence ENSEMBL: ENSMUSP00000132098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166117] [ENSMUST00000218487] [ENSMUST00000218547]
Predicted Effect probably damaging
Transcript: ENSMUST00000166117
AA Change: F444L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235
AA Change: F444L

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218487
AA Change: F379L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000218547
AA Change: V358A
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,458 L195P probably damaging Het
Adgrb1 T C 15: 74,541,611 V548A probably benign Het
Adgrb1 T C 15: 74,545,000 I752T probably damaging Het
Adh6a G T 3: 138,327,514 probably null Het
Aldh18a1 A G 19: 40,565,012 S431P probably benign Het
Arap3 T C 18: 37,991,357 R310G possibly damaging Het
Atad5 T C 11: 80,095,170 V361A possibly damaging Het
Atp8a1 C A 5: 67,762,582 M380I Het
Calcrl C T 2: 84,339,249 V363M possibly damaging Het
Camsap1 G T 2: 25,940,241 D490E probably damaging Het
Cd72 T A 4: 43,452,601 I131F possibly damaging Het
Cdh2 C T 18: 16,629,519 G513D probably benign Het
Cela1 T C 15: 100,682,941 T145A probably benign Het
Cfap99 C T 5: 34,323,391 R462C probably damaging Het
Cmtm1 A G 8: 104,309,941 S19P possibly damaging Het
Ctsm C G 13: 61,539,649 V100L probably benign Het
Cyp2c67 C A 19: 39,640,008 C164F probably benign Het
Cyp2d11 T C 15: 82,392,487 I84V probably benign Het
Cyp2j11 T C 4: 96,307,292 D389G probably damaging Het
Dctd A G 8: 48,111,690 D9G probably benign Het
Fam221a C A 6: 49,378,556 F197L probably damaging Het
Fbxl4 T G 4: 22,427,225 C489G possibly damaging Het
Fmn1 C T 2: 113,365,692 T579M unknown Het
Fndc3a G A 14: 72,574,380 L337F probably damaging Het
Gdnf C T 15: 7,834,762 S218L probably damaging Het
Gk5 A T 9: 96,174,703 D391V probably damaging Het
Gys2 T C 6: 142,427,410 T612A probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Isx T C 8: 74,889,999 F85L probably damaging Het
Kcnh5 T C 12: 74,897,859 D872G possibly damaging Het
Kif26b T G 1: 178,679,229 V290G possibly damaging Het
Ksr2 T C 5: 117,671,458 C429R probably damaging Het
Loxhd1 A C 18: 77,388,399 I1121L possibly damaging Het
Map2 T C 1: 66,414,743 F931L probably benign Het
Marc2 T A 1: 184,841,312 M130L possibly damaging Het
Mepce T C 5: 137,784,673 I464V probably benign Het
Mpo G T 11: 87,801,649 V538L probably benign Het
Myom1 T C 17: 71,084,295 V933A probably damaging Het
Ncmap C A 4: 135,377,064 M19I possibly damaging Het
Neb T A 2: 52,183,836 I5920F probably benign Het
Nnt C T 13: 119,374,676 V355I probably benign Het
Nr1i2 C T 16: 38,252,964 G217S probably damaging Het
Nsd1 A G 13: 55,310,367 R2098G possibly damaging Het
Parp4 A G 14: 56,647,246 T1261A probably benign Het
Pcgf3 A T 5: 108,487,857 N131I probably benign Het
Plcb2 C T 2: 118,710,821 D1012N probably benign Het
Plcl2 T C 17: 50,607,661 I566T probably damaging Het
Plekha1 G A 7: 130,908,372 A283T probably damaging Het
Prag1 A T 8: 36,099,925 M77L possibly damaging Het
Rhbdl2 A T 4: 123,824,918 I222L probably benign Het
Rnh1 A C 7: 141,160,704 V446G probably damaging Het
Sash1 C T 10: 8,751,041 R193H possibly damaging Het
Sgf29 G T 7: 126,672,654 V284L possibly damaging Het
Skiv2l2 T A 13: 112,872,983 K961* probably null Het
Slc12a3 G A 8: 94,330,384 G95D probably benign Het
Slc17a7 T C 7: 45,170,290 V172A probably damaging Het
Spta1 T C 1: 174,217,944 V1556A probably benign Het
Tex15 G A 8: 33,572,893 E784K possibly damaging Het
Ttn T C 2: 76,842,788 E11224G unknown Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zdbf2 C T 1: 63,306,413 T1317I possibly damaging Het
Zfat C T 15: 68,101,506 A1147T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zhx3 T G 2: 160,780,775 I491L probably benign Het
Zranb3 T C 1: 127,954,995 D1061G probably damaging Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
R7512:Gen1 UTSW 12 11260976 missense possibly damaging 0.79
R7692:Gen1 UTSW 12 11242166 missense probably benign 0.22
R7800:Gen1 UTSW 12 11241862 missense probably benign 0.00
R8061:Gen1 UTSW 12 11261076 splice site probably benign
R8112:Gen1 UTSW 12 11254373 nonsense probably null
R8147:Gen1 UTSW 12 11255050 intron probably null
R8153:Gen1 UTSW 12 11260947 missense probably damaging 1.00
R8161:Gen1 UTSW 12 11241464 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGCAAGAGCACTGTTTTCAC -3'
(R):5'- ACCCTCTGCATGTATGTAACTC -3'

Sequencing Primer
(F):5'- GAGCACTGTTTTCACTCTTGACAAAG -3'
(R):5'- CAGCATCTTAGAGCAAAAGTTGTG -3'
Posted On2020-06-30