Mutagenetix > Incidental Mutations

Incidental Mutation 'R0102:Olfr743'

63304

Institutional Source

Beutler Lab

Gene Symbol

Olfr743

Ensembl Gene

ENSMUSG00000094285

Gene Name

olfactory receptor 743

Synonyms

Olfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1

MMRRC Submission

038388-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R0102 (G1)

Quality Score

128

Status

Validated

Chromosome

Chromosomal Location

50521839-50534955 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 50533631 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 73 (L73Q)

Ref Sequence

ENSEMBL: ENSMUSP00000150946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071294
AA Change: L73Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: L73Q

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	311	1.6e-56	PFAM
Pfam:7tm_1	45	294	1e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215793
AA Change: L73Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.5%
20x: 91.8%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,068,113	K1021R	probably damaging	Het
2610528J11Rik	G	A	4: 118,529,565	V36M	probably damaging	Het
4930402F06Rik	T	A	2: 35,375,783	R292*	probably null	Het
Abcb4	T	C	5: 8,909,194	F207S	probably damaging	Het
Afap1l2	G	T	19: 56,928,440		probably benign	Het
Arfgef2	A	T	2: 166,845,465	H203L	probably benign	Het
Cfi	A	C	3: 129,848,767	H90P	probably damaging	Het
Col1a2	T	A	6: 4,520,775	S371T	possibly damaging	Het
Cyp2d10	C	T	15: 82,404,593	M229I	probably benign	Het
Dnah5	A	G	15: 28,245,751		probably benign	Het
Dnttip2	G	T	3: 122,275,803	M222I	probably benign	Het
Dync1li2	A	T	8: 104,428,125	Y284N	probably benign	Het
Ebf1	T	C	11: 44,991,455	Y413H	probably benign	Het
Exog	A	G	9: 119,452,253	T186A	possibly damaging	Het
Fam171a2	T	C	11: 102,444,113	N66S	possibly damaging	Het
Gad1	G	A	2: 70,587,239		probably null	Het
Golgb1	C	A	16: 36,875,468		probably benign	Het
Gprc5a	A	T	6: 135,079,035	N160I	probably damaging	Het
Haus3	A	G	5: 34,165,914		probably null	Het
Klhl20	A	T	1: 161,090,445	C90*	probably null	Het
Krt84	T	A	15: 101,528,703	I342L	probably damaging	Het
Lifr	G	A	15: 7,178,892	D584N	probably damaging	Het
Lrp1b	G	A	2: 41,408,985		probably benign	Het
Lrtm1	T	A	14: 29,022,227		probably benign	Het
Med25	C	T	7: 44,885,480	V80I	possibly damaging	Het
Mest	A	G	6: 30,746,270	I279V	probably damaging	Het
Mki67	T	C	7: 135,713,803	R81G	probably benign	Het
Naa25	A	G	5: 121,435,569	D787G	possibly damaging	Het
Naaladl1	C	T	19: 6,112,504	P465S	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Necab3	G	A	2: 154,545,312	R302C	probably damaging	Het
Nsg1	A	T	5: 38,158,910	D32E	probably damaging	Het
Nuggc	A	G	14: 65,613,551	D290G	probably null	Het
Nup205	A	T	6: 35,225,780		probably benign	Het
Olfr1100	A	T	2: 86,978,205	I197N	possibly damaging	Het
Olfr1216	T	C	2: 89,013,671	Y131C	probably damaging	Het
Olfr1250	T	C	2: 89,656,655	N262S	probably benign	Het
Olfr1308	G	C	2: 111,960,597	Q159E	probably damaging	Het
Olfr1361	T	C	13: 21,658,735	D196G	probably damaging	Het
Otp	T	C	13: 94,877,155	V27A	probably benign	Het
Phip	A	T	9: 82,905,792		probably null	Het
Pon2	A	G	6: 5,289,091		probably benign	Het
Ppp1r12b	T	A	1: 134,835,899		probably null	Het
Ppp1r15b	A	G	1: 133,133,170	N475S	probably damaging	Het
Prrt3	A	T	6: 113,497,829	L144H	probably damaging	Het
Psmb7	A	G	2: 38,643,365	V50A	possibly damaging	Het
Sacs	T	A	14: 61,204,568	S1354R	probably damaging	Het
Sdcbp2	A	G	2: 151,583,964	T29A	probably benign	Het
Shbg	T	A	11: 69,617,589		probably benign	Het
Shcbp1	A	G	8: 4,744,452	I447T	probably damaging	Het
Tbc1d9b	T	C	11: 50,135,849	V48A	probably damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trappc12	A	T	12: 28,746,752	F260L	probably damaging	Het
Trim10	C	A	17: 36,870,182	H102N	probably damaging	Het
Ube2u	A	G	4: 100,549,925	T215A	possibly damaging	Het
Vcan	T	G	13: 89,703,668	T1058P	probably benign	Het

Other mutations in Olfr743

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01128:Olfr743	APN	14	50533949	missense	probably damaging	1.00
IGL01551:Olfr743	APN	14	50534161	missense	probably benign
IGL02024:Olfr743	APN	14	50533850	missense	probably benign	0.00
IGL02867:Olfr743	APN	14	50533513	missense	probably benign
IGL02889:Olfr743	APN	14	50533513	missense	probably benign
IGL03195:Olfr743	APN	14	50533420	missense	probably benign
IGL03296:Olfr743	APN	14	50533945	missense	possibly damaging	0.90
R0049:Olfr743	UTSW	14	50533694	missense	probably damaging	1.00
R0049:Olfr743	UTSW	14	50533694	missense	probably damaging	1.00
R0556:Olfr743	UTSW	14	50533924	missense	probably benign	0.01
R0626:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0661:Olfr743	UTSW	14	50534095	missense	probably benign
R0759:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0761:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R0894:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1109:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1110:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1312:Olfr743	UTSW	14	50534195	missense	probably benign
R1446:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1470:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1470:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1502:Olfr743	UTSW	14	50533777	missense	possibly damaging	0.47
R1518:Olfr743	UTSW	14	50534165	missense	probably damaging	1.00
R1529:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1624:Olfr743	UTSW	14	50533643	missense	probably damaging	1.00
R1646:Olfr743	UTSW	14	50533583	missense	probably benign	0.01
R1687:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R1795:Olfr743	UTSW	14	50533702	missense	possibly damaging	0.78
R2011:Olfr743	UTSW	14	50533684	missense	probably damaging	1.00
R2120:Olfr743	UTSW	14	50533946	missense	probably damaging	1.00
R2697:Olfr743	UTSW	14	50533781	missense	probably damaging	1.00
R2857:Olfr743	UTSW	14	50533440	missense	probably benign	0.19
R2858:Olfr743	UTSW	14	50533440	missense	probably benign	0.19
R3906:Olfr743	UTSW	14	50533754	missense	probably benign	0.03
R4327:Olfr743	UTSW	14	50533514	missense	probably benign	0.05
R4355:Olfr743	UTSW	14	50533759	missense	possibly damaging	0.94
R4663:Olfr743	UTSW	14	50533604	missense	probably damaging	1.00
R5214:Olfr743	UTSW	14	50534347	makesense	probably null
R5964:Olfr743	UTSW	14	50534198	missense	probably damaging	0.99
R6148:Olfr743	UTSW	14	50534321	missense	probably benign	0.00
R6167:Olfr743	UTSW	14	50534155	missense	probably damaging	1.00
R6301:Olfr743	UTSW	14	50534254	missense	probably benign	0.02
R6616:Olfr743	UTSW	14	50533907	missense	probably benign	0.43
R6910:Olfr743	UTSW	14	50533873	missense	probably benign	0.31
R7076:Olfr743	UTSW	14	50533821	nonsense	probably null
R7483:Olfr743	UTSW	14	50534015	missense	probably benign	0.06
R7574:Olfr743	UTSW	14	50534313	missense	probably benign	0.01
R7731:Olfr743	UTSW	14	50533684	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGTGCTTTCACAGAACACAGACAG -3'
(R):5'- CGATCAAATGCCATGACTGCCAGG -3'

Sequencing Primer
(F):5'- ATCACAGGCTTCATCCTTTTGG -3'
(R):5'- TGACTGCCAGGAAAAAGCATTC -3'

Posted On

2013-07-30