Incidental Mutation 'R8152:Cdh2'
ID 633043
Institutional Source Beutler Lab
Gene Symbol Cdh2
Ensembl Gene ENSMUSG00000024304
Gene Name cadherin 2
Synonyms Ncad, N-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8152 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 16588877-16809246 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 16629519 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 513 (G513D)
Ref Sequence ENSEMBL: ENSMUSP00000025166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025166] [ENSMUST00000115850]
AlphaFold P15116
PDB Structure STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
N-CADHERIN, TWO-DOMAIN FRAGMENT [X-RAY DIFFRACTION]
Solution Structure of Neural Cadherin Prodomain [SOLUTION NMR]
Crystal structure of N-cadherin domains EC12 [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin ectodomain [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 A78SI92M [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 with AA insertion between residues 2 and 3 [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 W2F [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025166
AA Change: G513D

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025166
Gene: ENSMUSG00000024304
AA Change: G513D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Cadherin_pro 31 123 5.77e-34 SMART
low complexity region 129 141 N/A INTRINSIC
CA 182 265 3.37e-17 SMART
CA 289 380 2.15e-33 SMART
CA 403 496 4.38e-16 SMART
CA 519 603 2.27e-23 SMART
CA 623 708 5.54e-2 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:Cadherin_C 753 903 6.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115850
AA Change: G456D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000111516
Gene: ENSMUSG00000024304
AA Change: G456D

DomainStartEndE-ValueType
Cadherin_pro 1 66 3.44e-9 SMART
low complexity region 72 84 N/A INTRINSIC
CA 125 208 3.37e-17 SMART
CA 232 323 2.15e-33 SMART
CA 346 439 4.38e-16 SMART
CA 462 546 2.27e-23 SMART
CA 566 651 5.54e-2 SMART
transmembrane domain 667 689 N/A INTRINSIC
Pfam:Cadherin_C 690 847 2.5e-57 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 92.4%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Mice lacking the encoded protein exhibit severe developmental defects resulting in embryonic death. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in death by E10. Mutant embryos exhibit several developmental abnormalities such as growth retardation, an enlarged heart, distended pericardial sacs, abnormal heart tube, wavy neural tube, irregular somite shape,and abnormal embryo turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,458 L195P probably damaging Het
Adgrb1 T C 15: 74,541,611 V548A probably benign Het
Adgrb1 T C 15: 74,545,000 I752T probably damaging Het
Adgrb3 T C 1: 25,221,757 probably null Het
Adh6a G T 3: 138,327,514 probably null Het
Aldh18a1 A G 19: 40,565,012 S431P probably benign Het
Arap3 T C 18: 37,991,357 R310G possibly damaging Het
Atad5 T C 11: 80,095,170 V361A possibly damaging Het
Atp8a1 C A 5: 67,762,582 M380I Het
Calcrl C T 2: 84,339,249 V363M possibly damaging Het
Camsap1 G T 2: 25,940,241 D490E probably damaging Het
Cd72 T A 4: 43,452,601 I131F possibly damaging Het
Cela1 T C 15: 100,682,941 T145A probably benign Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfap99 C T 5: 34,323,391 R462C probably damaging Het
Cmtm1 A G 8: 104,309,941 S19P possibly damaging Het
Crebbp A T 16: 4,085,081 M2098K possibly damaging Het
Csmd3 T C 15: 47,669,464 probably null Het
Ctsm C G 13: 61,539,649 V100L probably benign Het
Cyp2c67 C A 19: 39,640,008 C164F probably benign Het
Cyp2d11 T C 15: 82,392,487 I84V probably benign Het
Cyp2j11 T C 4: 96,307,292 D389G probably damaging Het
Dctd A G 8: 48,111,690 D9G probably benign Het
Fam221a C A 6: 49,378,556 F197L probably damaging Het
Fbxl4 T G 4: 22,427,225 C489G possibly damaging Het
Fmn1 C T 2: 113,365,692 T579M unknown Het
Fndc3a G A 14: 72,574,380 L337F probably damaging Het
Frmpd2 A G 14: 33,543,287 probably null Het
Gdnf C T 15: 7,834,762 S218L probably damaging Het
Gen1 A G 12: 11,243,265 F444L probably damaging Het
Gk5 A T 9: 96,174,703 D391V probably damaging Het
Gys2 T C 6: 142,427,410 T612A probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Isx T C 8: 74,889,999 F85L probably damaging Het
Kcnh5 T C 12: 74,897,859 D872G possibly damaging Het
Kif26b T G 1: 178,679,229 V290G possibly damaging Het
Ksr2 T C 5: 117,671,458 C429R probably damaging Het
Loxhd1 A C 18: 77,388,399 I1121L possibly damaging Het
Map2 T C 1: 66,414,743 F931L probably benign Het
Marc2 T A 1: 184,841,312 M130L possibly damaging Het
Mepce T C 5: 137,784,673 I464V probably benign Het
Mpo G T 11: 87,801,649 V538L probably benign Het
Myom1 T C 17: 71,084,295 V933A probably damaging Het
Nckap1l T G 15: 103,478,530 probably null Het
Ncmap C A 4: 135,377,064 M19I possibly damaging Het
Neb T A 2: 52,183,836 I5920F probably benign Het
Nnt C T 13: 119,374,676 V355I probably benign Het
Nr1i2 C T 16: 38,252,964 G217S probably damaging Het
Nsd1 A G 13: 55,310,367 R2098G possibly damaging Het
Parp4 A G 14: 56,647,246 T1261A probably benign Het
Pcgf3 A T 5: 108,487,857 N131I probably benign Het
Plcb2 C T 2: 118,710,821 D1012N probably benign Het
Plcl2 T C 17: 50,607,661 I566T probably damaging Het
Plekha1 G A 7: 130,908,372 A283T probably damaging Het
Prag1 A T 8: 36,099,925 M77L possibly damaging Het
Rhbdl2 A T 4: 123,824,918 I222L probably benign Het
Rnh1 A C 7: 141,160,704 V446G probably damaging Het
Sash1 C T 10: 8,751,041 R193H possibly damaging Het
Sgf29 G T 7: 126,672,654 V284L possibly damaging Het
Skiv2l2 T A 13: 112,872,983 K961* probably null Het
Slc12a3 G A 8: 94,330,384 G95D probably benign Het
Slc17a7 T C 7: 45,170,290 V172A probably damaging Het
Spta1 T C 1: 174,217,944 V1556A probably benign Het
Tex15 G A 8: 33,572,893 E784K possibly damaging Het
Ttn T C 2: 76,842,788 E11224G unknown Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zdbf2 C T 1: 63,306,413 T1317I possibly damaging Het
Zfat C T 15: 68,101,506 A1147T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zhx3 T G 2: 160,780,775 I491L probably benign Het
Zranb3 T C 1: 127,954,995 D1061G probably damaging Het
Other mutations in Cdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Cdh2 APN 18 16627636 missense possibly damaging 0.69
IGL01560:Cdh2 APN 18 16650438 missense probably benign 0.01
IGL02028:Cdh2 APN 18 16650420 missense probably benign 0.07
IGL02227:Cdh2 APN 18 16629586 missense probably benign 0.01
IGL02229:Cdh2 APN 18 16624753 missense probably benign
IGL02617:Cdh2 APN 18 16627604 missense probably damaging 1.00
IGL02685:Cdh2 APN 18 16646500 missense probably damaging 1.00
IGL02724:Cdh2 APN 18 16629480 missense probably benign 0.29
R0111:Cdh2 UTSW 18 16774509 missense probably benign
R0173:Cdh2 UTSW 18 16650257 splice site probably benign
R0197:Cdh2 UTSW 18 16629576 missense probably benign
R0563:Cdh2 UTSW 18 16629681 missense possibly damaging 0.90
R0883:Cdh2 UTSW 18 16629576 missense probably benign
R1083:Cdh2 UTSW 18 16643959 missense possibly damaging 0.61
R1270:Cdh2 UTSW 18 16627557 splice site probably benign
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1510:Cdh2 UTSW 18 16648594 missense probably benign
R1875:Cdh2 UTSW 18 16624877 missense probably benign
R2122:Cdh2 UTSW 18 16774543 missense probably benign 0.01
R2194:Cdh2 UTSW 18 16640448 missense probably damaging 1.00
R2254:Cdh2 UTSW 18 16643928 critical splice donor site probably null
R4471:Cdh2 UTSW 18 16774476 splice site probably null
R4501:Cdh2 UTSW 18 16629585 missense possibly damaging 0.53
R4620:Cdh2 UTSW 18 16648608 missense probably benign
R4832:Cdh2 UTSW 18 16627697 missense probably benign 0.01
R4944:Cdh2 UTSW 18 16650409 missense probably damaging 0.99
R4958:Cdh2 UTSW 18 16627565 splice site probably null
R5160:Cdh2 UTSW 18 16629587 missense probably damaging 0.99
R5190:Cdh2 UTSW 18 16650315 missense possibly damaging 0.54
R5446:Cdh2 UTSW 18 16646627 missense probably damaging 1.00
R5552:Cdh2 UTSW 18 16640463 missense possibly damaging 0.88
R5699:Cdh2 UTSW 18 16646522 nonsense probably null
R5912:Cdh2 UTSW 18 16640450 missense possibly damaging 0.79
R5949:Cdh2 UTSW 18 16601630 missense probably damaging 1.00
R6313:Cdh2 UTSW 18 16774522 missense probably benign 0.00
R6633:Cdh2 UTSW 18 16640548 missense probably benign 0.00
R7822:Cdh2 UTSW 18 16624284 missense probably benign 0.24
R8022:Cdh2 UTSW 18 16590301 missense probably damaging 1.00
R8142:Cdh2 UTSW 18 16601734 missense probably benign 0.00
R8188:Cdh2 UTSW 18 16648536 missense probably damaging 1.00
R8461:Cdh2 UTSW 18 16650465 missense probably benign 0.44
R8491:Cdh2 UTSW 18 16624718 critical splice donor site probably null
R9246:Cdh2 UTSW 18 16648597 nonsense probably null
R9477:Cdh2 UTSW 18 16622155 missense probably damaging 1.00
R9530:Cdh2 UTSW 18 16650409 missense probably damaging 0.99
R9581:Cdh2 UTSW 18 16670055 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGAATCTGAATCTATGCACGAAATTCC -3'
(R):5'- CGAATAGGATGTTTGTCCTTACTG -3'

Sequencing Primer
(F):5'- GAATCTATGCACGAAATTCCTAGAG -3'
(R):5'- GTCCTTACTGTTGCTGCAGAAAAC -3'
Posted On 2020-06-30