Incidental Mutation 'R8152:Cyp2c67'
ID633046
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 67
SynonymsC730004C24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8152 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location39608842-39649051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39640008 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 164 (C164F)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
Predicted Effect probably benign
Transcript: ENSMUST00000067328
AA Change: C164F

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: C164F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 92.4%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,458 L195P probably damaging Het
Adgrb1 T C 15: 74,541,611 V548A probably benign Het
Adgrb1 T C 15: 74,545,000 I752T probably damaging Het
Adgrb3 T C 1: 25,221,757 probably null Het
Adh6a G T 3: 138,327,514 probably null Het
Aldh18a1 A G 19: 40,565,012 S431P probably benign Het
Arap3 T C 18: 37,991,357 R310G possibly damaging Het
Atad5 T C 11: 80,095,170 V361A possibly damaging Het
Atp8a1 C A 5: 67,762,582 M380I Het
Calcrl C T 2: 84,339,249 V363M possibly damaging Het
Camsap1 G T 2: 25,940,241 D490E probably damaging Het
Cd72 T A 4: 43,452,601 I131F possibly damaging Het
Cdh2 C T 18: 16,629,519 G513D probably benign Het
Cela1 T C 15: 100,682,941 T145A probably benign Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfap99 C T 5: 34,323,391 R462C probably damaging Het
Cmtm1 A G 8: 104,309,941 S19P possibly damaging Het
Crebbp A T 16: 4,085,081 M2098K possibly damaging Het
Csmd3 T C 15: 47,669,464 probably null Het
Ctsm C G 13: 61,539,649 V100L probably benign Het
Cyp2d11 T C 15: 82,392,487 I84V probably benign Het
Cyp2j11 T C 4: 96,307,292 D389G probably damaging Het
Dctd A G 8: 48,111,690 D9G probably benign Het
Fam221a C A 6: 49,378,556 F197L probably damaging Het
Fbxl4 T G 4: 22,427,225 C489G possibly damaging Het
Fmn1 C T 2: 113,365,692 T579M unknown Het
Fndc3a G A 14: 72,574,380 L337F probably damaging Het
Frmpd2 A G 14: 33,543,287 probably null Het
Gdnf C T 15: 7,834,762 S218L probably damaging Het
Gen1 A G 12: 11,243,265 F444L probably damaging Het
Gk5 A T 9: 96,174,703 D391V probably damaging Het
Gys2 T C 6: 142,427,410 T612A probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Isx T C 8: 74,889,999 F85L probably damaging Het
Kcnh5 T C 12: 74,897,859 D872G possibly damaging Het
Kif26b T G 1: 178,679,229 V290G possibly damaging Het
Ksr2 T C 5: 117,671,458 C429R probably damaging Het
Loxhd1 A C 18: 77,388,399 I1121L possibly damaging Het
Map2 T C 1: 66,414,743 F931L probably benign Het
Marc2 T A 1: 184,841,312 M130L possibly damaging Het
Mepce T C 5: 137,784,673 I464V probably benign Het
Mpo G T 11: 87,801,649 V538L probably benign Het
Myom1 T C 17: 71,084,295 V933A probably damaging Het
Nckap1l T G 15: 103,478,530 probably null Het
Ncmap C A 4: 135,377,064 M19I possibly damaging Het
Neb T A 2: 52,183,836 I5920F probably benign Het
Nnt C T 13: 119,374,676 V355I probably benign Het
Nr1i2 C T 16: 38,252,964 G217S probably damaging Het
Nsd1 A G 13: 55,310,367 R2098G possibly damaging Het
Parp4 A G 14: 56,647,246 T1261A probably benign Het
Pcgf3 A T 5: 108,487,857 N131I probably benign Het
Plcb2 C T 2: 118,710,821 D1012N probably benign Het
Plcl2 T C 17: 50,607,661 I566T probably damaging Het
Plekha1 G A 7: 130,908,372 A283T probably damaging Het
Prag1 A T 8: 36,099,925 M77L possibly damaging Het
Rhbdl2 A T 4: 123,824,918 I222L probably benign Het
Rnh1 A C 7: 141,160,704 V446G probably damaging Het
Sash1 C T 10: 8,751,041 R193H possibly damaging Het
Sgf29 G T 7: 126,672,654 V284L possibly damaging Het
Skiv2l2 T A 13: 112,872,983 K961* probably null Het
Slc12a3 G A 8: 94,330,384 G95D probably benign Het
Slc17a7 T C 7: 45,170,290 V172A probably damaging Het
Spta1 T C 1: 174,217,944 V1556A probably benign Het
Tex15 G A 8: 33,572,893 E784K possibly damaging Het
Ttn T C 2: 76,842,788 E11224G unknown Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zdbf2 C T 1: 63,306,413 T1317I possibly damaging Het
Zfat C T 15: 68,101,506 A1147T probably benign Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zhx3 T G 2: 160,780,775 I491L probably benign Het
Zranb3 T C 1: 127,954,995 D1061G probably damaging Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAAAACCTTGGCTTTACCTGAC -3'
(R):5'- TAAGGTCCTTGAATGAAGCAGTG -3'

Sequencing Primer
(F):5'- GGCTTTACCTGACACCCAG -3'
(R):5'- AGTCAGGTTTAATGTCAGCAAGATC -3'
Posted On2020-06-30