Mutagenetix > Incidental Mutations

Incidental Mutation 'R0102:Sacs'

63305

Institutional Source

Beutler Lab

Gene Symbol

Sacs

Ensembl Gene

ENSMUSG00000048279

Gene Name

sacsin

Synonyms

E130115J16Rik

MMRRC Submission

038388-MU

Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0102 (G1)

Quality Score

168

Status

Validated

Chromosome

Chromosomal Location

61138457-61240695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61204568 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1354 (S1354R)

Ref Sequence

ENSEMBL: ENSMUSP00000113377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943] [ENSMUST00000227570] [ENSMUST00000229692]

Predicted Effect

probably benign
Transcript: ENSMUST00000089394

SMART Domains

Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119943
AA Change: S1354R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: S1354R

Domain	Start	End	E-Value	Type
internal_repeat_1	61	514	1.35e-52	PROSPERO
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC
low complexity region	1019	1033	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1526	1537	N/A	INTRINSIC
low complexity region	2454	2463	N/A	INTRINSIC
internal_repeat_1	2475	2934	1.35e-52	PROSPERO
low complexity region	3751	3760	N/A	INTRINSIC
low complexity region	3997	4012	N/A	INTRINSIC
low complexity region	4285	4300	N/A	INTRINSIC
Blast:DnaJ	4304	4363	1e-31	BLAST
PDB:1IUR\|A	4309	4376	5e-39	PDB
SCOP:d1gh6a_	4317	4407	2e-3	SMART
HEPN	4454	4570	9.49e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150222

Predicted Effect

probably benign
Transcript: ENSMUST00000227570

Predicted Effect

probably benign
Transcript: ENSMUST00000229692

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.5%
20x: 91.8%

Validation Efficiency

98% (65/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,068,113	K1021R	probably damaging	Het
2610528J11Rik	G	A	4: 118,529,565	V36M	probably damaging	Het
4930402F06Rik	T	A	2: 35,375,783	R292*	probably null	Het
Abcb4	T	C	5: 8,909,194	F207S	probably damaging	Het
Afap1l2	G	T	19: 56,928,440		probably benign	Het
Arfgef2	A	T	2: 166,845,465	H203L	probably benign	Het
Cfi	A	C	3: 129,848,767	H90P	probably damaging	Het
Col1a2	T	A	6: 4,520,775	S371T	possibly damaging	Het
Cyp2d10	C	T	15: 82,404,593	M229I	probably benign	Het
Dnah5	A	G	15: 28,245,751		probably benign	Het
Dnttip2	G	T	3: 122,275,803	M222I	probably benign	Het
Dync1li2	A	T	8: 104,428,125	Y284N	probably benign	Het
Ebf1	T	C	11: 44,991,455	Y413H	probably benign	Het
Exog	A	G	9: 119,452,253	T186A	possibly damaging	Het
Fam171a2	T	C	11: 102,444,113	N66S	possibly damaging	Het
Gad1	G	A	2: 70,587,239		probably null	Het
Golgb1	C	A	16: 36,875,468		probably benign	Het
Gprc5a	A	T	6: 135,079,035	N160I	probably damaging	Het
Haus3	A	G	5: 34,165,914		probably null	Het
Klhl20	A	T	1: 161,090,445	C90*	probably null	Het
Krt84	T	A	15: 101,528,703	I342L	probably damaging	Het
Lifr	G	A	15: 7,178,892	D584N	probably damaging	Het
Lrp1b	G	A	2: 41,408,985		probably benign	Het
Lrtm1	T	A	14: 29,022,227		probably benign	Het
Med25	C	T	7: 44,885,480	V80I	possibly damaging	Het
Mest	A	G	6: 30,746,270	I279V	probably damaging	Het
Mki67	T	C	7: 135,713,803	R81G	probably benign	Het
Naa25	A	G	5: 121,435,569	D787G	possibly damaging	Het
Naaladl1	C	T	19: 6,112,504	P465S	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Necab3	G	A	2: 154,545,312	R302C	probably damaging	Het
Nsg1	A	T	5: 38,158,910	D32E	probably damaging	Het
Nuggc	A	G	14: 65,613,551	D290G	probably null	Het
Nup205	A	T	6: 35,225,780		probably benign	Het
Olfr1100	A	T	2: 86,978,205	I197N	possibly damaging	Het
Olfr1216	T	C	2: 89,013,671	Y131C	probably damaging	Het
Olfr1250	T	C	2: 89,656,655	N262S	probably benign	Het
Olfr1308	G	C	2: 111,960,597	Q159E	probably damaging	Het
Olfr1361	T	C	13: 21,658,735	D196G	probably damaging	Het
Olfr743	T	A	14: 50,533,631	L73Q	probably damaging	Het
Otp	T	C	13: 94,877,155	V27A	probably benign	Het
Phip	A	T	9: 82,905,792		probably null	Het
Pon2	A	G	6: 5,289,091		probably benign	Het
Ppp1r12b	T	A	1: 134,835,899		probably null	Het
Ppp1r15b	A	G	1: 133,133,170	N475S	probably damaging	Het
Prrt3	A	T	6: 113,497,829	L144H	probably damaging	Het
Psmb7	A	G	2: 38,643,365	V50A	possibly damaging	Het
Sdcbp2	A	G	2: 151,583,964	T29A	probably benign	Het
Shbg	T	A	11: 69,617,589		probably benign	Het
Shcbp1	A	G	8: 4,744,452	I447T	probably damaging	Het
Tbc1d9b	T	C	11: 50,135,849	V48A	probably damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trappc12	A	T	12: 28,746,752	F260L	probably damaging	Het
Trim10	C	A	17: 36,870,182	H102N	probably damaging	Het
Ube2u	A	G	4: 100,549,925	T215A	possibly damaging	Het
Vcan	T	G	13: 89,703,668	T1058P	probably benign	Het

Other mutations in Sacs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Sacs	APN	14	61191635	missense	possibly damaging	0.64
IGL01839:Sacs	APN	14	61183945	intron	probably benign
IGL02024:Sacs	APN	14	61189678	missense	probably damaging	0.96
IGL02247:Sacs	APN	14	61192535	missense	probably damaging	1.00
BB009:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
BB019:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
F6893:Sacs	UTSW	14	61212976	missense	probably benign
IGL03052:Sacs	UTSW	14	61207858	missense	probably damaging	0.99
R0090:Sacs	UTSW	14	61205440	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0390:Sacs	UTSW	14	61205640	missense	possibly damaging	0.92
R0479:Sacs	UTSW	14	61191479	missense	probably damaging	0.99
R0556:Sacs	UTSW	14	61183958	missense	probably damaging	0.99
R0673:Sacs	UTSW	14	61210215	missense	possibly damaging	0.89
R0748:Sacs	UTSW	14	61209265	missense	probably damaging	0.99
R0931:Sacs	UTSW	14	61203495	missense	probably benign
R0972:Sacs	UTSW	14	61211963	nonsense	probably null
R1281:Sacs	UTSW	14	61191801	missense	probably benign	0.02
R1340:Sacs	UTSW	14	61204509	missense	probably damaging	0.98
R1351:Sacs	UTSW	14	61202761	missense	probably benign	0.00
R1499:Sacs	UTSW	14	61213704	missense	possibly damaging	0.70
R1538:Sacs	UTSW	14	61210059	missense	probably damaging	0.98
R1581:Sacs	UTSW	14	61213679	missense	probably damaging	0.96
R1599:Sacs	UTSW	14	61203638	missense	probably benign
R1631:Sacs	UTSW	14	61210732	nonsense	probably null
R1635:Sacs	UTSW	14	61203828	missense	probably damaging	0.98
R1655:Sacs	UTSW	14	61191782	missense	probably benign
R1660:Sacs	UTSW	14	61209009	missense	probably damaging	0.99
R1707:Sacs	UTSW	14	61209762	missense	probably benign	0.01
R1733:Sacs	UTSW	14	61205454	missense	probably damaging	1.00
R1772:Sacs	UTSW	14	61210897	missense	probably damaging	1.00
R1976:Sacs	UTSW	14	61202895	missense	probably benign
R2055:Sacs	UTSW	14	61214049	missense	probably damaging	0.97
R2083:Sacs	UTSW	14	61206506	missense	possibly damaging	0.69
R2091:Sacs	UTSW	14	61191919	missense	possibly damaging	0.95
R2105:Sacs	UTSW	14	61173441	missense	possibly damaging	0.90
R2109:Sacs	UTSW	14	61173453	splice site	probably null
R2117:Sacs	UTSW	14	61213771	missense	probably benign	0.01
R2122:Sacs	UTSW	14	61212316	missense	probably damaging	1.00
R2148:Sacs	UTSW	14	61173378	missense	probably damaging	0.97
R2151:Sacs	UTSW	14	61209640	missense	probably damaging	1.00
R2231:Sacs	UTSW	14	61205929	splice site	probably null
R2248:Sacs	UTSW	14	61212802	missense	probably damaging	1.00
R2271:Sacs	UTSW	14	61204660	missense	probably benign	0.06
R2314:Sacs	UTSW	14	61207759	missense	probably benign	0.17
R2436:Sacs	UTSW	14	61202905	missense	possibly damaging	0.94
R2445:Sacs	UTSW	14	61205206	missense	probably damaging	1.00
R2512:Sacs	UTSW	14	61203080	missense	probably benign	0.00
R3434:Sacs	UTSW	14	61212303	missense	probably damaging	1.00
R3785:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3786:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3796:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3798:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3872:Sacs	UTSW	14	61148068	missense	probably benign	0.30
R3873:Sacs	UTSW	14	61192286	missense	possibly damaging	0.64
R3892:Sacs	UTSW	14	61204387	missense	probably damaging	0.98
R4184:Sacs	UTSW	14	61213944	missense	probably damaging	0.97
R4204:Sacs	UTSW	14	61173443	missense	possibly damaging	0.93
R4249:Sacs	UTSW	14	61203457	missense	probably benign	0.02
R4256:Sacs	UTSW	14	61206337	missense	probably damaging	1.00
R4370:Sacs	UTSW	14	61212309	missense	probably damaging	1.00
R4445:Sacs	UTSW	14	61204686	missense	probably benign	0.30
R4503:Sacs	UTSW	14	61207603	missense	probably damaging	1.00
R4548:Sacs	UTSW	14	61191938	missense	probably damaging	1.00
R4582:Sacs	UTSW	14	61191698	missense	probably damaging	1.00
R4613:Sacs	UTSW	14	61211797	splice site	probably null
R4639:Sacs	UTSW	14	61207268	missense	probably benign	0.12
R4697:Sacs	UTSW	14	61212747	missense	probably benign	0.19
R4706:Sacs	UTSW	14	61204273	missense	probably damaging	1.00
R4717:Sacs	UTSW	14	61212855	missense	probably damaging	1.00
R4777:Sacs	UTSW	14	61211809	missense	probably damaging	1.00
R4888:Sacs	UTSW	14	61212198	missense	probably damaging	1.00
R4913:Sacs	UTSW	14	61213797	missense	probably benign	0.17
R4973:Sacs	UTSW	14	61213122	missense	probably damaging	1.00
R4986:Sacs	UTSW	14	61213043	nonsense	probably null
R5090:Sacs	UTSW	14	61205253	missense	probably damaging	1.00
R5243:Sacs	UTSW	14	61205957	nonsense	probably null
R5292:Sacs	UTSW	14	61211983	missense	probably damaging	1.00
R5308:Sacs	UTSW	14	61192400	missense	probably benign	0.21
R5337:Sacs	UTSW	14	61193514	intron	probably benign
R5502:Sacs	UTSW	14	61206100	missense	probably damaging	1.00
R5586:Sacs	UTSW	14	61206441	nonsense	probably null
R5692:Sacs	UTSW	14	61207839	missense	probably benign	0.00
R5725:Sacs	UTSW	14	61211110	missense	probably damaging	1.00
R5854:Sacs	UTSW	14	61211547	missense	probably damaging	1.00
R5959:Sacs	UTSW	14	61212400	missense	probably damaging	0.99
R5960:Sacs	UTSW	14	61208695	missense	probably benign	0.30
R5968:Sacs	UTSW	14	61189629	missense	probably damaging	0.99
R5983:Sacs	UTSW	14	61205199	missense	probably damaging	1.00
R5992:Sacs	UTSW	14	61205543	missense	probably damaging	1.00
R6076:Sacs	UTSW	14	61204536	nonsense	probably null
R6175:Sacs	UTSW	14	61212826	missense	possibly damaging	0.82
R6347:Sacs	UTSW	14	61211160	missense	probably damaging	1.00
R6357:Sacs	UTSW	14	61208824	missense	possibly damaging	0.47
R6415:Sacs	UTSW	14	61205359	missense	probably damaging	1.00
R6469:Sacs	UTSW	14	61191248	missense	probably damaging	1.00
R6503:Sacs	UTSW	14	61211361	missense	probably benign	0.00
R6523:Sacs	UTSW	14	61202961	missense	probably damaging	0.99
R6615:Sacs	UTSW	14	61208934	missense	probably benign	0.15
R6729:Sacs	UTSW	14	61210518	missense	probably damaging	1.00
R6731:Sacs	UTSW	14	61180700	splice site	probably null
R6797:Sacs	UTSW	14	61213073	missense	probably damaging	1.00
R6852:Sacs	UTSW	14	61179288	missense	possibly damaging	0.87
R6922:Sacs	UTSW	14	61211425	missense	probably damaging	1.00
R7023:Sacs	UTSW	14	61208815	missense	probably benign	0.04
R7047:Sacs	UTSW	14	61213002	missense	probably damaging	1.00
R7051:Sacs	UTSW	14	61208928	missense	probably benign	0.25
R7069:Sacs	UTSW	14	61212496	missense	probably damaging	1.00
R7082:Sacs	UTSW	14	61210517	missense	possibly damaging	0.94
R7108:Sacs	UTSW	14	61211009	nonsense	probably null
R7122:Sacs	UTSW	14	61210396	missense	probably damaging	1.00
R7194:Sacs	UTSW	14	61210089	missense	possibly damaging	0.95
R7214:Sacs	UTSW	14	61191792	missense	probably benign
R7221:Sacs	UTSW	14	61208806	missense	probably damaging	0.99
R7274:Sacs	UTSW	14	61214081	missense	possibly damaging	0.88
R7344:Sacs	UTSW	14	61207444	missense	possibly damaging	0.81
R7440:Sacs	UTSW	14	61191605	missense	probably benign	0.10
R7474:Sacs	UTSW	14	61211178	missense	probably benign	0.04
R7512:Sacs	UTSW	14	61204430	missense	probably benign	0.04
R7641:Sacs	UTSW	14	61202871	missense	probably damaging	0.97
R7649:Sacs	UTSW	14	61203228	missense	possibly damaging	0.53
R7703:Sacs	UTSW	14	61206090	missense	possibly damaging	0.81
R7792:Sacs	UTSW	14	61209773	missense	probably benign	0.00
R7805:Sacs	UTSW	14	61203591	missense	not run
R7822:Sacs	UTSW	14	61192203	missense	probably benign	0.03
R7882:Sacs	UTSW	14	61207071	missense	probably benign	0.02
R7932:Sacs	UTSW	14	61204878	missense	probably damaging	0.99
R8031:Sacs	UTSW	14	61204191	missense	probably damaging	0.96
R8064:Sacs	UTSW	14	61192175	missense	possibly damaging	0.92
R8083:Sacs	UTSW	14	61210717	missense	possibly damaging	0.77
R8204:Sacs	UTSW	14	61212948	missense	probably damaging	0.96
R8293:Sacs	UTSW	14	61191099	missense	probably damaging	0.99
R8316:Sacs	UTSW	14	61189619	missense	possibly damaging	0.84
R8393:Sacs	UTSW	14	61173206	start codon destroyed	probably null	0.06
R8434:Sacs	UTSW	14	61213187	nonsense	probably null
R8482:Sacs	UTSW	14	61202955	missense	probably benign
R8497:Sacs	UTSW	14	61192253	missense	probably benign	0.00
R8557:Sacs	UTSW	14	61207276	missense	probably damaging	1.00
X0067:Sacs	UTSW	14	61208019	missense	probably damaging	1.00
Z1176:Sacs	UTSW	14	61210830	nonsense	probably null
Z1176:Sacs	UTSW	14	61213200	missense	probably damaging	1.00
Z1177:Sacs	UTSW	14	61191551	missense	possibly damaging	0.48
Z1177:Sacs	UTSW	14	61207981	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCCCAGGCTGTGATAAAGCCAAC -3'
(R):5'- AGTAAGAGGCTCTCTTTGCCCTGAC -3'

Sequencing Primer
(F):5'- GTGATAAAGCCAACCCATGATCTG -3'
(R):5'- GATCAGTCTTGTACTAAGGCACG -3'

Posted On

2013-07-30