Mutagenetix > Incidental Mutation

Incidental Mutation 'R8157:Ash1l'

633050

Institutional Source

Beutler Lab

Gene Symbol

Ash1l

Ensembl Gene

ENSMUSG00000028053

Gene Name

ASH1 like histone lysine methyltransferase

Synonyms

E430018P19Rik, 8030453L17Rik, KMT2H, chromatin remodeling factor

MMRRC Submission

067583-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8157 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88857929-88986682 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 88971014 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000088451 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000090933

SMART Domains

Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000186583

SMART Domains

Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310011J03Rik	T	A	10: 80,155,361 (GRCm39)	R51W	probably damaging	Het
Adam3	A	G	8: 25,197,453 (GRCm39)	I326T	probably benign	Het
Alpk3	A	G	7: 80,743,470 (GRCm39)	K1096E	probably benign	Het
Aph1a	T	C	3: 95,802,150 (GRCm39)	V44A	possibly damaging	Het
Atg2b	A	G	12: 105,629,199 (GRCm39)	M410T	probably damaging	Het
Castor2	T	C	5: 134,165,936 (GRCm39)	F228S	possibly damaging	Het
Ccdc15	C	T	9: 37,226,753 (GRCm39)	G407D	probably benign	Het
Cd200r4	T	A	16: 44,653,504 (GRCm39)	N137K	probably damaging	Het
Clec18a	A	G	8: 111,798,683 (GRCm39)	L438P	probably damaging	Het
Clip1	A	G	5: 123,768,782 (GRCm39)	S606P	probably benign	Het
Col11a2	G	A	17: 34,280,230 (GRCm39)	G1193E	unknown	Het
Col6a4	A	G	9: 105,945,097 (GRCm39)	S1006P	possibly damaging	Het
Ctsc	A	T	7: 87,951,416 (GRCm39)	D221V	probably benign	Het
Ctse	T	C	1: 131,600,249 (GRCm39)	Y333H	probably damaging	Het
Cyp2c23	T	C	19: 44,010,066 (GRCm39)	N93S	probably benign	Het
Daam1	A	T	12: 71,999,263 (GRCm39)	D633V	probably damaging	Het
Dlg2	G	A	7: 92,036,140 (GRCm39)	R607H	probably damaging	Het
Dsg2	T	A	18: 20,713,606 (GRCm39)	D192E	probably damaging	Het
Dync2h1	A	T	9: 7,001,473 (GRCm39)	N3838K	possibly damaging	Het
Ephx2	A	C	14: 66,345,506 (GRCm39)	S153A	probably damaging	Het
Eprs1	C	A	1: 185,130,591 (GRCm39)	H651N	probably benign	Het
Fat2	T	C	11: 55,142,910 (GRCm39)	D4313G	possibly damaging	Het
Fras1	A	G	5: 96,702,714 (GRCm39)	K252R	probably benign	Het
Galt	A	T	4: 41,757,226 (GRCm39)	Q193L	probably benign	Het
Gm7356	T	C	17: 14,221,583 (GRCm39)	K149E	probably damaging	Het
Gmcl1	G	T	6: 86,698,408 (GRCm39)	A163E	probably damaging	Het
Hectd1	T	A	12: 51,838,073 (GRCm39)	R696S	possibly damaging	Het
Hydin	A	G	8: 111,178,668 (GRCm39)	I1088V	probably benign	Het
Igkv4-68	A	T	6: 69,282,306 (GRCm39)	S14R	probably benign	Het
Lamb2	C	T	9: 108,357,845 (GRCm39)	R123W	probably damaging	Het
Ldlrad4	C	T	18: 68,387,293 (GRCm39)	R202*	probably null	Het
Lrit3	T	C	3: 129,594,284 (GRCm39)	T98A	probably benign	Het
Macc1	A	G	12: 119,409,728 (GRCm39)	I165M	probably benign	Het
Mapre2	T	A	18: 23,991,218 (GRCm39)	M162K	probably benign	Het
Mzf1	T	A	7: 12,778,279 (GRCm39)	H454L	probably damaging	Het
Naa30	T	A	14: 49,410,865 (GRCm39)	N264K	probably benign	Het
Or5ac17	A	G	16: 59,036,352 (GRCm39)	V208A	probably benign	Het
Or8d2	T	A	9: 38,759,762 (GRCm39)	Y117*	probably null	Het
Osr2	T	C	15: 35,302,063 (GRCm39)	I221T	probably benign	Het
Pcdh12	A	T	18: 38,415,850 (GRCm39)	I425K	probably benign	Het
Pcdhb3	T	G	18: 37,436,292 (GRCm39)	Y753D	probably damaging	Het
Pcdhb9	T	A	18: 37,536,208 (GRCm39)	V734E	probably damaging	Het
Pibf1	T	A	14: 99,433,831 (GRCm39)	L593I	probably benign	Het
Prag1	G	A	8: 36,614,393 (GRCm39)	C1315Y	probably damaging	Het
Prl3c1	T	C	13: 27,383,330 (GRCm39)	S19P	probably damaging	Het
Ptprz1	A	T	6: 23,002,539 (GRCm39)	D1543V	probably damaging	Het
Ripor2	A	G	13: 24,879,600 (GRCm39)	N356S	probably benign	Het
Rmc1	T	C	18: 12,321,690 (GRCm39)	V497A	possibly damaging	Het
Saxo4	A	T	19: 10,455,629 (GRCm39)	F207I	probably damaging	Het
Scrib	T	C	15: 75,931,037 (GRCm39)	H914R	possibly damaging	Het
Sema6b	G	A	17: 56,435,448 (GRCm39)	A265V	probably damaging	Het
Tdrd9	C	G	12: 111,951,500 (GRCm39)	L97V	probably benign	Het
Tle7	A	G	8: 110,835,493 (GRCm39)	M24V	probably benign	Het
Trabd	T	A	15: 88,970,024 (GRCm39)	L340H	probably damaging	Het
Trpm1	T	C	7: 63,849,017 (GRCm39)	W88R	probably damaging	Het
Txndc12	G	T	4: 108,710,419 (GRCm39)		probably null	Het
Vmn1r175	T	C	7: 23,508,523 (GRCm39)	I35V	probably benign	Het
Vmn1r48	A	T	6: 90,012,994 (GRCm39)	V277E	probably damaging	Het
Vmn2r72	G	A	7: 85,400,441 (GRCm39)	H203Y	probably benign	Het
Zbtb7c	A	G	18: 76,270,398 (GRCm39)	E162G	probably benign	Het
Zfp93	T	A	7: 23,975,885 (GRCm39)	C623*	probably null	Het
Zzz3	A	G	3: 152,155,285 (GRCm39)	I645V	probably null	Het

Other mutations in Ash1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ash1l	APN	3	88,889,019 (GRCm39)	missense	probably benign	0.19
IGL00819:Ash1l	APN	3	88,915,043 (GRCm39)	missense	possibly damaging	0.68
IGL00939:Ash1l	APN	3	88,942,543 (GRCm39)	missense	probably damaging	0.99
IGL01064:Ash1l	APN	3	88,979,791 (GRCm39)	missense	probably damaging	1.00
IGL01066:Ash1l	APN	3	88,891,942 (GRCm39)	missense	probably damaging	1.00
IGL01087:Ash1l	APN	3	88,971,209 (GRCm39)	missense	probably damaging	1.00
IGL01293:Ash1l	APN	3	88,890,836 (GRCm39)	missense	probably benign	0.01
IGL01541:Ash1l	APN	3	88,973,572 (GRCm39)	missense	probably damaging	1.00
IGL01863:Ash1l	APN	3	88,892,813 (GRCm39)	nonsense	probably null
IGL02326:Ash1l	APN	3	88,873,364 (GRCm39)	missense	probably benign	0.00
IGL02407:Ash1l	APN	3	88,979,855 (GRCm39)	missense	probably damaging	1.00
IGL02419:Ash1l	APN	3	88,892,872 (GRCm39)	missense	probably benign	0.00
IGL02422:Ash1l	APN	3	88,976,386 (GRCm39)	critical splice donor site	probably null
IGL02494:Ash1l	APN	3	88,973,525 (GRCm39)	nonsense	probably null
IGL02727:Ash1l	APN	3	88,930,344 (GRCm39)	missense	probably benign
IGL02732:Ash1l	APN	3	88,873,535 (GRCm39)	missense	probably damaging	1.00
IGL02817:Ash1l	APN	3	88,892,108 (GRCm39)	missense	probably damaging	1.00
IGL02887:Ash1l	APN	3	88,891,488 (GRCm39)	missense	probably benign	0.11
IGL03224:Ash1l	APN	3	88,942,575 (GRCm39)	splice site	probably benign
IGL03253:Ash1l	APN	3	88,891,981 (GRCm39)	missense	probably damaging	1.00
IGL03327:Ash1l	APN	3	88,930,390 (GRCm39)	missense	probably benign	0.02
IGL03398:Ash1l	APN	3	88,914,527 (GRCm39)	missense	probably benign	0.01
3-1:Ash1l	UTSW	3	88,873,633 (GRCm39)	missense	probably benign
BB008:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
BB018:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
R0068:Ash1l	UTSW	3	88,914,624 (GRCm39)	missense	probably benign	0.17
R0068:Ash1l	UTSW	3	88,914,624 (GRCm39)	missense	probably benign	0.17
R0239:Ash1l	UTSW	3	88,974,529 (GRCm39)	missense	possibly damaging	0.49
R0239:Ash1l	UTSW	3	88,974,529 (GRCm39)	missense	possibly damaging	0.49
R0395:Ash1l	UTSW	3	88,965,896 (GRCm39)	missense	probably damaging	1.00
R0477:Ash1l	UTSW	3	88,890,766 (GRCm39)	missense	probably benign	0.41
R0528:Ash1l	UTSW	3	88,889,584 (GRCm39)	missense	probably benign
R0543:Ash1l	UTSW	3	88,971,085 (GRCm39)	splice site	probably null
R0855:Ash1l	UTSW	3	88,961,761 (GRCm39)	missense	possibly damaging	0.82
R1147:Ash1l	UTSW	3	88,892,194 (GRCm39)	missense	possibly damaging	0.72
R1147:Ash1l	UTSW	3	88,892,194 (GRCm39)	missense	possibly damaging	0.72
R1163:Ash1l	UTSW	3	88,942,570 (GRCm39)	critical splice donor site	probably null
R1196:Ash1l	UTSW	3	88,890,623 (GRCm39)	missense	probably damaging	0.99
R1419:Ash1l	UTSW	3	88,892,204 (GRCm39)	missense	probably damaging	0.99
R1445:Ash1l	UTSW	3	88,914,659 (GRCm39)	missense	probably benign	0.02
R1466:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1466:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1480:Ash1l	UTSW	3	88,892,359 (GRCm39)	missense	probably damaging	1.00
R1506:Ash1l	UTSW	3	88,965,806 (GRCm39)	missense	probably damaging	0.99
R1537:Ash1l	UTSW	3	88,979,783 (GRCm39)	missense	probably damaging	0.99
R1584:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1669:Ash1l	UTSW	3	88,974,549 (GRCm39)	critical splice donor site	probably null
R1713:Ash1l	UTSW	3	88,983,531 (GRCm39)	missense	probably damaging	1.00
R1780:Ash1l	UTSW	3	88,873,291 (GRCm39)	missense	probably benign
R1793:Ash1l	UTSW	3	88,977,616 (GRCm39)	missense	probably damaging	1.00
R1881:Ash1l	UTSW	3	88,888,862 (GRCm39)	missense	probably benign	0.00
R1909:Ash1l	UTSW	3	88,891,835 (GRCm39)	missense	probably benign	0.29
R1938:Ash1l	UTSW	3	88,891,729 (GRCm39)	missense	probably damaging	0.98
R2035:Ash1l	UTSW	3	88,973,624 (GRCm39)	missense	probably benign	0.00
R2070:Ash1l	UTSW	3	88,873,510 (GRCm39)	missense	probably damaging	1.00
R2071:Ash1l	UTSW	3	88,873,510 (GRCm39)	missense	probably damaging	1.00
R2114:Ash1l	UTSW	3	88,890,571 (GRCm39)	missense	probably benign	0.00
R2116:Ash1l	UTSW	3	88,890,571 (GRCm39)	missense	probably benign	0.00
R2118:Ash1l	UTSW	3	88,892,602 (GRCm39)	missense	possibly damaging	0.80
R2143:Ash1l	UTSW	3	88,892,726 (GRCm39)	missense	probably benign	0.09
R2164:Ash1l	UTSW	3	88,892,726 (GRCm39)	missense	probably benign	0.09
R2210:Ash1l	UTSW	3	88,973,605 (GRCm39)	missense	probably damaging	1.00
R2247:Ash1l	UTSW	3	88,914,674 (GRCm39)	missense	possibly damaging	0.77
R2303:Ash1l	UTSW	3	88,933,733 (GRCm39)	missense	probably damaging	1.00
R2860:Ash1l	UTSW	3	88,961,785 (GRCm39)	missense	probably damaging	1.00
R2861:Ash1l	UTSW	3	88,961,785 (GRCm39)	missense	probably damaging	1.00
R3104:Ash1l	UTSW	3	88,961,693 (GRCm39)	missense	probably damaging	1.00
R4133:Ash1l	UTSW	3	88,889,567 (GRCm39)	missense	probably benign	0.00
R4164:Ash1l	UTSW	3	88,889,273 (GRCm39)	missense	probably damaging	0.97
R4270:Ash1l	UTSW	3	88,889,347 (GRCm39)	missense	probably benign	0.26
R4271:Ash1l	UTSW	3	88,889,347 (GRCm39)	missense	probably benign	0.26
R4287:Ash1l	UTSW	3	88,973,722 (GRCm39)	missense	probably damaging	0.99
R4409:Ash1l	UTSW	3	88,914,506 (GRCm39)	missense	probably damaging	0.99
R4459:Ash1l	UTSW	3	88,873,541 (GRCm39)	missense	probably damaging	0.99
R4487:Ash1l	UTSW	3	88,892,622 (GRCm39)	missense	possibly damaging	0.65
R4674:Ash1l	UTSW	3	88,979,783 (GRCm39)	missense	possibly damaging	0.80
R4739:Ash1l	UTSW	3	88,890,152 (GRCm39)	missense	probably benign	0.19
R4927:Ash1l	UTSW	3	88,892,641 (GRCm39)	missense	probably damaging	1.00
R5000:Ash1l	UTSW	3	88,965,941 (GRCm39)	missense	probably damaging	1.00
R5016:Ash1l	UTSW	3	88,889,630 (GRCm39)	missense	probably damaging	1.00
R5055:Ash1l	UTSW	3	88,930,519 (GRCm39)	critical splice donor site	probably null
R5081:Ash1l	UTSW	3	88,892,024 (GRCm39)	missense	probably damaging	1.00
R5082:Ash1l	UTSW	3	88,873,541 (GRCm39)	missense	probably damaging	0.99
R5090:Ash1l	UTSW	3	88,960,184 (GRCm39)	missense	probably damaging	1.00
R5113:Ash1l	UTSW	3	88,973,582 (GRCm39)	missense	probably damaging	0.99
R5408:Ash1l	UTSW	3	88,889,701 (GRCm39)	missense	probably damaging	1.00
R5452:Ash1l	UTSW	3	88,892,183 (GRCm39)	missense	possibly damaging	0.93
R5487:Ash1l	UTSW	3	88,888,733 (GRCm39)	missense	probably benign	0.17
R5610:Ash1l	UTSW	3	88,930,492 (GRCm39)	missense	probably damaging	1.00
R5624:Ash1l	UTSW	3	88,892,916 (GRCm39)	missense	probably damaging	1.00
R5682:Ash1l	UTSW	3	88,914,914 (GRCm39)	missense	probably damaging	0.99
R5712:Ash1l	UTSW	3	88,959,297 (GRCm39)	missense	probably damaging	0.99
R5719:Ash1l	UTSW	3	88,965,933 (GRCm39)	missense	probably damaging	1.00
R5719:Ash1l	UTSW	3	88,961,805 (GRCm39)	missense	possibly damaging	0.83
R5839:Ash1l	UTSW	3	88,890,658 (GRCm39)	missense	probably damaging	0.99
R5859:Ash1l	UTSW	3	88,976,300 (GRCm39)	missense	probably damaging	1.00
R5877:Ash1l	UTSW	3	88,888,891 (GRCm39)	missense	probably benign	0.00
R5940:Ash1l	UTSW	3	88,891,343 (GRCm39)	missense	probably damaging	0.96
R6026:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6027:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6029:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6089:Ash1l	UTSW	3	88,960,450 (GRCm39)	nonsense	probably null
R6110:Ash1l	UTSW	3	88,892,436 (GRCm39)	missense	probably damaging	1.00
R6168:Ash1l	UTSW	3	88,960,080 (GRCm39)	nonsense	probably null
R6200:Ash1l	UTSW	3	88,977,834 (GRCm39)	missense	probably damaging	1.00
R6290:Ash1l	UTSW	3	88,890,068 (GRCm39)	nonsense	probably null
R6331:Ash1l	UTSW	3	88,915,172 (GRCm39)	missense	probably benign	0.00
R6425:Ash1l	UTSW	3	88,891,087 (GRCm39)	missense	probably damaging	0.99
R6540:Ash1l	UTSW	3	88,892,368 (GRCm39)	missense	probably damaging	1.00
R6568:Ash1l	UTSW	3	88,959,344 (GRCm39)	missense	probably benign	0.09
R6828:Ash1l	UTSW	3	88,983,420 (GRCm39)	missense	probably benign	0.00
R6843:Ash1l	UTSW	3	88,892,695 (GRCm39)	missense	probably damaging	1.00
R6894:Ash1l	UTSW	3	88,890,298 (GRCm39)	missense	probably benign	0.00
R6976:Ash1l	UTSW	3	88,888,964 (GRCm39)	missense	possibly damaging	0.77
R7038:Ash1l	UTSW	3	88,889,978 (GRCm39)	missense	probably benign	0.00
R7073:Ash1l	UTSW	3	88,892,647 (GRCm39)	missense	probably damaging	1.00
R7133:Ash1l	UTSW	3	88,890,764 (GRCm39)	frame shift	probably null
R7150:Ash1l	UTSW	3	88,984,381 (GRCm39)	missense	probably damaging	1.00
R7205:Ash1l	UTSW	3	88,873,259 (GRCm39)	missense	probably benign	0.00
R7254:Ash1l	UTSW	3	88,977,816 (GRCm39)	missense	probably damaging	1.00
R7272:Ash1l	UTSW	3	88,961,941 (GRCm39)	splice site	probably null
R7288:Ash1l	UTSW	3	88,873,199 (GRCm39)	start gained	probably benign
R7319:Ash1l	UTSW	3	88,888,694 (GRCm39)	missense	probably benign	0.19
R7341:Ash1l	UTSW	3	88,889,066 (GRCm39)	missense	possibly damaging	0.93
R7342:Ash1l	UTSW	3	88,873,304 (GRCm39)	missense	possibly damaging	0.94
R7454:Ash1l	UTSW	3	88,891,172 (GRCm39)	missense	probably benign	0.16
R7677:Ash1l	UTSW	3	88,950,500 (GRCm39)	missense	probably damaging	1.00
R7822:Ash1l	UTSW	3	88,914,571 (GRCm39)	missense	probably benign
R7857:Ash1l	UTSW	3	88,891,616 (GRCm39)	nonsense	probably null
R7889:Ash1l	UTSW	3	88,873,345 (GRCm39)	missense	probably benign	0.00
R7898:Ash1l	UTSW	3	88,890,932 (GRCm39)	missense	possibly damaging	0.54
R7931:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
R7937:Ash1l	UTSW	3	88,977,624 (GRCm39)	nonsense	probably null
R7973:Ash1l	UTSW	3	88,960,164 (GRCm39)	missense	probably benign
R8119:Ash1l	UTSW	3	88,942,734 (GRCm39)	missense	probably damaging	1.00
R8162:Ash1l	UTSW	3	88,977,553 (GRCm39)	missense	probably damaging	0.99
R8194:Ash1l	UTSW	3	88,960,062 (GRCm39)	missense	probably damaging	1.00
R8306:Ash1l	UTSW	3	88,873,259 (GRCm39)	missense	probably benign	0.00
R8497:Ash1l	UTSW	3	88,914,951 (GRCm39)	missense	probably benign	0.02
R8558:Ash1l	UTSW	3	88,891,713 (GRCm39)	missense	probably damaging	0.96
R8744:Ash1l	UTSW	3	88,965,890 (GRCm39)	missense	possibly damaging	0.89
R8923:Ash1l	UTSW	3	88,892,974 (GRCm39)	missense	possibly damaging	0.51
R8969:Ash1l	UTSW	3	88,873,598 (GRCm39)	missense	possibly damaging	0.52
R8970:Ash1l	UTSW	3	88,976,307 (GRCm39)	missense	probably benign	0.00
R9002:Ash1l	UTSW	3	88,888,715 (GRCm39)	missense	probably benign	0.17
R9023:Ash1l	UTSW	3	88,892,576 (GRCm39)	missense	probably damaging	1.00
R9032:Ash1l	UTSW	3	88,891,529 (GRCm39)	missense	probably benign	0.00
R9032:Ash1l	UTSW	3	88,889,294 (GRCm39)	missense	probably benign	0.19
R9049:Ash1l	UTSW	3	88,914,671 (GRCm39)	missense	probably benign
R9085:Ash1l	UTSW	3	88,891,529 (GRCm39)	missense	probably benign	0.00
R9085:Ash1l	UTSW	3	88,889,294 (GRCm39)	missense	probably benign	0.19
R9130:Ash1l	UTSW	3	88,965,848 (GRCm39)	nonsense	probably null
R9149:Ash1l	UTSW	3	88,914,530 (GRCm39)	missense	probably benign
R9294:Ash1l	UTSW	3	88,890,297 (GRCm39)	missense	possibly damaging	0.90
R9365:Ash1l	UTSW	3	88,889,207 (GRCm39)	missense	possibly damaging	0.63
R9450:Ash1l	UTSW	3	88,915,139 (GRCm39)	missense	possibly damaging	0.86
R9542:Ash1l	UTSW	3	88,950,566 (GRCm39)	missense	probably damaging	1.00
R9558:Ash1l	UTSW	3	88,889,521 (GRCm39)	missense	probably benign	0.02
R9572:Ash1l	UTSW	3	88,960,188 (GRCm39)	missense	probably damaging	1.00
R9688:Ash1l	UTSW	3	88,892,024 (GRCm39)	missense	probably damaging	1.00
R9736:Ash1l	UTSW	3	88,891,733 (GRCm39)	missense	probably damaging	1.00
R9765:Ash1l	UTSW	3	88,930,500 (GRCm39)	missense	probably damaging	1.00
R9789:Ash1l	UTSW	3	88,873,373 (GRCm39)	missense	probably benign
X0017:Ash1l	UTSW	3	88,891,892 (GRCm39)	missense	probably benign	0.45
X0019:Ash1l	UTSW	3	88,977,863 (GRCm39)	missense	probably damaging	1.00
X0021:Ash1l	UTSW	3	88,890,511 (GRCm39)	missense	probably benign	0.10
Z1088:Ash1l	UTSW	3	88,890,016 (GRCm39)	missense	probably benign	0.00
Z1176:Ash1l	UTSW	3	88,950,524 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTTCACCATGTGCTGTAGAGC -3'
(R):5'- AGCATCGAAAGCCTCCACTG -3'

Sequencing Primer
(F):5'- TGTAGAGCAGCTAAACTACAGAGCAC -3'
(R):5'- CCACTGTTTTGTAATACCCAATGAGG -3'

Posted On

2020-06-30