Incidental Mutation 'R8157:Mzf1'
ID633063
Institutional Source Beutler Lab
Gene Symbol Mzf1
Ensembl Gene ENSMUSG00000030380
Gene Namemyeloid zinc finger 1
SynonymsZnf42, Zfp121, Zfp98, Mzf2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R8157 (G1)
Quality Score213.009
Status Not validated
Chromosome7
Chromosomal Location13042303-13054764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13044352 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 454 (H454L)
Ref Sequence ENSEMBL: ENSMUSP00000138271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069289] [ENSMUST00000182087] [ENSMUST00000182490] [ENSMUST00000182515]
Predicted Effect probably benign
Transcript: ENSMUST00000069289
SMART Domains Protein: ENSMUSP00000069122
Gene: ENSMUSG00000030380

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182087
SMART Domains Protein: ENSMUSP00000138163
Gene: ENSMUSG00000030380

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 152 9.06e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182490
AA Change: H454L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138271
Gene: ENSMUSG00000030380
AA Change: H454L

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
SCAN 120 232 1.18e-70 SMART
ZnF_C2H2 436 458 4.87e-4 SMART
ZnF_C2H2 464 486 1.95e-3 SMART
ZnF_C2H2 492 514 1.18e-2 SMART
ZnF_C2H2 520 542 8.6e-5 SMART
ZnF_C2H2 565 587 1.79e-2 SMART
ZnF_C2H2 593 615 7.15e-2 SMART
ZnF_C2H2 621 643 8.47e-4 SMART
ZnF_C2H2 649 671 2.79e-4 SMART
ZnF_C2H2 677 699 1.6e-4 SMART
ZnF_C2H2 705 727 1.67e-2 SMART
ZnF_C2H2 733 755 3.44e-4 SMART
ZnF_C2H2 761 783 2.84e-5 SMART
ZnF_C2H2 789 811 2.4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182515
AA Change: H375L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138387
Gene: ENSMUSG00000030380
AA Change: H375L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants are prone to late-onset (>2 yr) neoplasias characterized by infiltration, enlargement and disruption of the liver by monomorphic cells of myeloid origin; hemopoietic progenitors show increased ability to sustain long-term hemopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T A 10: 80,319,527 R51W probably damaging Het
3110002H16Rik T C 18: 12,188,633 V497A possibly damaging Het
Adam3 A G 8: 24,707,437 I326T probably benign Het
Alpk3 A G 7: 81,093,722 K1096E probably benign Het
Aph1a T C 3: 95,894,838 V44A possibly damaging Het
Ash1l T A 3: 89,063,707 probably null Het
Atg2b A G 12: 105,662,940 M410T probably damaging Het
Ccdc15 C T 9: 37,315,457 G407D probably benign Het
Cd200r4 T A 16: 44,833,141 N137K probably damaging Het
Clec18a A G 8: 111,072,051 L438P probably damaging Het
Clip1 A G 5: 123,630,719 S606P probably benign Het
Col11a2 G A 17: 34,061,256 G1193E unknown Het
Col6a4 A G 9: 106,067,898 S1006P possibly damaging Het
Ctsc A T 7: 88,302,208 D221V probably benign Het
Ctse T C 1: 131,672,511 Y333H probably damaging Het
Cyp2c23 T C 19: 44,021,627 N93S probably benign Het
Daam1 A T 12: 71,952,489 D633V probably damaging Het
Dlg2 G A 7: 92,386,932 R607H probably damaging Het
Dsg2 T A 18: 20,580,549 D192E probably damaging Het
Dync2h1 A T 9: 7,001,473 N3838K possibly damaging Het
Ephx2 A C 14: 66,108,057 S153A probably damaging Het
Eprs C A 1: 185,398,394 H651N probably benign Het
Fat2 T C 11: 55,252,084 D4313G possibly damaging Het
Fras1 A G 5: 96,554,855 K252R probably benign Het
Galt A T 4: 41,757,226 Q193L probably benign Het
Gatsl2 T C 5: 134,137,097 F228S possibly damaging Het
Gm21964 A G 8: 110,108,861 M24V probably benign Het
Gm7356 T C 17: 14,001,321 K149E probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd1 T A 12: 51,791,290 R696S possibly damaging Het
Hydin A G 8: 110,452,036 I1088V probably benign Het
Igkv4-68 A T 6: 69,305,322 S14R probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lrit3 T C 3: 129,800,635 T98A probably benign Het
Macc1 A G 12: 119,445,993 I165M probably benign Het
Mapre2 T A 18: 23,858,161 M162K probably benign Het
Naa30 T A 14: 49,173,408 N264K probably benign Het
Olfr199 A G 16: 59,215,989 V208A probably benign Het
Olfr924 T A 9: 38,848,466 Y117* probably null Het
Osr2 T C 15: 35,301,917 I221T probably benign Het
Pcdh12 A T 18: 38,282,797 I425K probably benign Het
Pcdhb3 T G 18: 37,303,239 Y753D probably damaging Het
Pcdhb9 T A 18: 37,403,155 V734E probably damaging Het
Pibf1 T A 14: 99,196,395 L593I probably benign Het
Ppp1r32 A T 19: 10,478,265 F207I probably damaging Het
Prag1 G A 8: 36,147,239 C1315Y probably damaging Het
Prl3c1 T C 13: 27,199,347 S19P probably damaging Het
Ptprz1 A T 6: 23,002,540 D1543V probably damaging Het
Ripor2 A G 13: 24,695,617 N356S probably benign Het
Scrib T C 15: 76,059,188 H914R possibly damaging Het
Sema6b G A 17: 56,128,448 A265V probably damaging Het
Tdrd9 C G 12: 111,985,066 L97V probably benign Het
Trabd T A 15: 89,085,821 L340H probably damaging Het
Trpm1 T C 7: 64,199,269 W88R probably damaging Het
Txndc12 G T 4: 108,853,222 probably null Het
Vmn1r175 T C 7: 23,809,098 I35V probably benign Het
Vmn1r48 A T 6: 90,036,012 V277E probably damaging Het
Vmn2r72 G A 7: 85,751,233 H203Y probably benign Het
Zbtb7c A G 18: 76,137,327 E162G probably benign Het
Zfp93 T A 7: 24,276,460 C623* probably null Het
Zzz3 A G 3: 152,449,648 I645V probably null Het
Other mutations in Mzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Mzf1 APN 7 13044616 missense possibly damaging 0.85
IGL01728:Mzf1 APN 7 13051727 splice site probably benign
IGL02194:Mzf1 APN 7 13043720 missense possibly damaging 0.53
IGL02256:Mzf1 APN 7 13052737 splice site probably benign
IGL02584:Mzf1 APN 7 13052817 missense probably damaging 0.98
IGL02678:Mzf1 APN 7 13052909 missense probably benign 0.00
R0903:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0904:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0905:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1128:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1131:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1280:Mzf1 UTSW 7 13053083 missense probably damaging 0.96
R1400:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1640:Mzf1 UTSW 7 13043270 makesense probably null
R1687:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R4014:Mzf1 UTSW 7 13043956 missense possibly damaging 0.47
R4721:Mzf1 UTSW 7 13043296 missense possibly damaging 0.52
R4721:Mzf1 UTSW 7 13043521 missense possibly damaging 0.53
R5511:Mzf1 UTSW 7 13051599 missense possibly damaging 0.95
R5611:Mzf1 UTSW 7 13044627 utr 3 prime probably benign
R5728:Mzf1 UTSW 7 13044058 missense probably benign 0.00
R5868:Mzf1 UTSW 7 13053189 missense probably benign 0.00
R6283:Mzf1 UTSW 7 13053369 intron probably benign
R7059:Mzf1 UTSW 7 13053058 missense probably damaging 0.96
R7066:Mzf1 UTSW 7 13043563 missense possibly damaging 0.92
R7763:Mzf1 UTSW 7 13044091 missense probably damaging 1.00
R8870:Mzf1 UTSW 7 13052909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCTCTGGCCACACTCTG -3'
(R):5'- TGCAGATGGACAGCATCACG -3'

Sequencing Primer
(F):5'- ACACTCTGTGCAGCGGAAC -3'
(R):5'- TAGCCTCTCTGGACAGATACAGTC -3'
Posted On2020-06-30