Incidental Mutation 'R8157:Dync2h1'
ID 633076
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Name dynein cytoplasmic 2 heavy chain 1
Synonyms DHC1b, b2b414Clo, Dnchc2, m407Asp, m152Asp, D030010H02Rik, 4432416O06Rik, DHC2, D330044F14Rik
MMRRC Submission 067583-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8157 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 6928550-7177619 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7001473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 3838 (N3838K)
Ref Sequence ENSEMBL: ENSMUSP00000046733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048417
AA Change: N3838K

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: N3838K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140466
AA Change: N3838K

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: N3838K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147193
AA Change: N3845K

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: N3845K

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T A 10: 80,155,361 (GRCm39) R51W probably damaging Het
Adam3 A G 8: 25,197,453 (GRCm39) I326T probably benign Het
Alpk3 A G 7: 80,743,470 (GRCm39) K1096E probably benign Het
Aph1a T C 3: 95,802,150 (GRCm39) V44A possibly damaging Het
Ash1l T A 3: 88,971,014 (GRCm39) probably null Het
Atg2b A G 12: 105,629,199 (GRCm39) M410T probably damaging Het
Castor2 T C 5: 134,165,936 (GRCm39) F228S possibly damaging Het
Ccdc15 C T 9: 37,226,753 (GRCm39) G407D probably benign Het
Cd200r4 T A 16: 44,653,504 (GRCm39) N137K probably damaging Het
Clec18a A G 8: 111,798,683 (GRCm39) L438P probably damaging Het
Clip1 A G 5: 123,768,782 (GRCm39) S606P probably benign Het
Col11a2 G A 17: 34,280,230 (GRCm39) G1193E unknown Het
Col6a4 A G 9: 105,945,097 (GRCm39) S1006P possibly damaging Het
Ctsc A T 7: 87,951,416 (GRCm39) D221V probably benign Het
Ctse T C 1: 131,600,249 (GRCm39) Y333H probably damaging Het
Cyp2c23 T C 19: 44,010,066 (GRCm39) N93S probably benign Het
Daam1 A T 12: 71,999,263 (GRCm39) D633V probably damaging Het
Dlg2 G A 7: 92,036,140 (GRCm39) R607H probably damaging Het
Dsg2 T A 18: 20,713,606 (GRCm39) D192E probably damaging Het
Ephx2 A C 14: 66,345,506 (GRCm39) S153A probably damaging Het
Eprs1 C A 1: 185,130,591 (GRCm39) H651N probably benign Het
Fat2 T C 11: 55,142,910 (GRCm39) D4313G possibly damaging Het
Fras1 A G 5: 96,702,714 (GRCm39) K252R probably benign Het
Galt A T 4: 41,757,226 (GRCm39) Q193L probably benign Het
Gm7356 T C 17: 14,221,583 (GRCm39) K149E probably damaging Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Hectd1 T A 12: 51,838,073 (GRCm39) R696S possibly damaging Het
Hydin A G 8: 111,178,668 (GRCm39) I1088V probably benign Het
Igkv4-68 A T 6: 69,282,306 (GRCm39) S14R probably benign Het
Lamb2 C T 9: 108,357,845 (GRCm39) R123W probably damaging Het
Ldlrad4 C T 18: 68,387,293 (GRCm39) R202* probably null Het
Lrit3 T C 3: 129,594,284 (GRCm39) T98A probably benign Het
Macc1 A G 12: 119,409,728 (GRCm39) I165M probably benign Het
Mapre2 T A 18: 23,991,218 (GRCm39) M162K probably benign Het
Mzf1 T A 7: 12,778,279 (GRCm39) H454L probably damaging Het
Naa30 T A 14: 49,410,865 (GRCm39) N264K probably benign Het
Or5ac17 A G 16: 59,036,352 (GRCm39) V208A probably benign Het
Or8d2 T A 9: 38,759,762 (GRCm39) Y117* probably null Het
Osr2 T C 15: 35,302,063 (GRCm39) I221T probably benign Het
Pcdh12 A T 18: 38,415,850 (GRCm39) I425K probably benign Het
Pcdhb3 T G 18: 37,436,292 (GRCm39) Y753D probably damaging Het
Pcdhb9 T A 18: 37,536,208 (GRCm39) V734E probably damaging Het
Pibf1 T A 14: 99,433,831 (GRCm39) L593I probably benign Het
Prag1 G A 8: 36,614,393 (GRCm39) C1315Y probably damaging Het
Prl3c1 T C 13: 27,383,330 (GRCm39) S19P probably damaging Het
Ptprz1 A T 6: 23,002,539 (GRCm39) D1543V probably damaging Het
Ripor2 A G 13: 24,879,600 (GRCm39) N356S probably benign Het
Rmc1 T C 18: 12,321,690 (GRCm39) V497A possibly damaging Het
Saxo4 A T 19: 10,455,629 (GRCm39) F207I probably damaging Het
Scrib T C 15: 75,931,037 (GRCm39) H914R possibly damaging Het
Sema6b G A 17: 56,435,448 (GRCm39) A265V probably damaging Het
Tdrd9 C G 12: 111,951,500 (GRCm39) L97V probably benign Het
Tle7 A G 8: 110,835,493 (GRCm39) M24V probably benign Het
Trabd T A 15: 88,970,024 (GRCm39) L340H probably damaging Het
Trpm1 T C 7: 63,849,017 (GRCm39) W88R probably damaging Het
Txndc12 G T 4: 108,710,419 (GRCm39) probably null Het
Vmn1r175 T C 7: 23,508,523 (GRCm39) I35V probably benign Het
Vmn1r48 A T 6: 90,012,994 (GRCm39) V277E probably damaging Het
Vmn2r72 G A 7: 85,400,441 (GRCm39) H203Y probably benign Het
Zbtb7c A G 18: 76,270,398 (GRCm39) E162G probably benign Het
Zfp93 T A 7: 23,975,885 (GRCm39) C623* probably null Het
Zzz3 A G 3: 152,155,285 (GRCm39) I645V probably null Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7,158,839 (GRCm39) missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7,155,072 (GRCm39) splice site probably benign
IGL00499:Dync2h1 APN 9 7,168,700 (GRCm39) missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7,035,728 (GRCm39) splice site probably benign
IGL00660:Dync2h1 APN 9 7,075,797 (GRCm39) missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7,174,881 (GRCm39) splice site probably benign
IGL01025:Dync2h1 APN 9 7,162,789 (GRCm39) missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7,145,611 (GRCm39) missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7,176,771 (GRCm39) missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7,116,588 (GRCm39) missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7,102,493 (GRCm39) missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7,071,111 (GRCm39) missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7,071,922 (GRCm39) missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7,140,897 (GRCm39) critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7,118,884 (GRCm39) nonsense probably null
IGL01681:Dync2h1 APN 9 7,142,196 (GRCm39) splice site probably null
IGL01685:Dync2h1 APN 9 7,142,297 (GRCm39) missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7,081,077 (GRCm39) missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7,114,922 (GRCm39) missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7,118,822 (GRCm39) unclassified probably benign
IGL01813:Dync2h1 APN 9 7,122,799 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,114,973 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,011,207 (GRCm39) missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7,075,892 (GRCm39) missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7,134,349 (GRCm39) missense probably benign
IGL02140:Dync2h1 APN 9 7,147,791 (GRCm39) missense probably benign
IGL02175:Dync2h1 APN 9 7,111,548 (GRCm39) missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7,125,912 (GRCm39) missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7,122,678 (GRCm39) missense probably benign
IGL02342:Dync2h1 APN 9 7,142,246 (GRCm39) missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7,158,926 (GRCm39) missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7,117,422 (GRCm39) missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7,035,700 (GRCm39) missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6,955,901 (GRCm39) splice site probably benign
IGL02955:Dync2h1 APN 9 7,142,864 (GRCm39) missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7,137,074 (GRCm39) missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6,935,279 (GRCm39) missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7,076,235 (GRCm39) missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7,125,918 (GRCm39) missense probably benign
IGL03233:Dync2h1 APN 9 7,101,525 (GRCm39) missense possibly damaging 0.90
deinonychus UTSW 9 7,159,478 (GRCm39) splice site probably null
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0043:Dync2h1 UTSW 9 7,005,574 (GRCm39) missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7,001,327 (GRCm39) splice site probably benign
R0277:Dync2h1 UTSW 9 7,129,046 (GRCm39) missense probably benign
R0360:Dync2h1 UTSW 9 7,113,182 (GRCm39) missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7,005,487 (GRCm39) splice site probably null
R0389:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0443:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0496:Dync2h1 UTSW 9 7,155,180 (GRCm39) missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7,113,153 (GRCm39) missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7,122,692 (GRCm39) missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7,120,954 (GRCm39) splice site probably null
R0564:Dync2h1 UTSW 9 7,139,432 (GRCm39) missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7,103,680 (GRCm39) missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7,015,497 (GRCm39) missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7,116,642 (GRCm39) critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7,077,979 (GRCm39) missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7,041,734 (GRCm39) splice site probably benign
R0938:Dync2h1 UTSW 9 7,002,658 (GRCm39) missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7,147,731 (GRCm39) missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7,005,488 (GRCm39) critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7,101,193 (GRCm39) splice site probably benign
R1243:Dync2h1 UTSW 9 7,120,882 (GRCm39) missense probably benign
R1295:Dync2h1 UTSW 9 7,075,752 (GRCm39) splice site probably benign
R1304:Dync2h1 UTSW 9 7,102,318 (GRCm39) missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7,125,816 (GRCm39) missense probably benign
R1513:Dync2h1 UTSW 9 7,103,663 (GRCm39) missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7,140,911 (GRCm39) missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7,157,553 (GRCm39) missense probably null 0.02
R1570:Dync2h1 UTSW 9 7,176,926 (GRCm39) missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6,993,942 (GRCm39) missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7,131,891 (GRCm39) missense probably benign
R1766:Dync2h1 UTSW 9 7,015,526 (GRCm39) critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7,128,256 (GRCm39) missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7,081,084 (GRCm39) missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7,049,166 (GRCm39) missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7,001,448 (GRCm39) missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7,001,377 (GRCm39) missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7,129,045 (GRCm39) missense probably benign
R2012:Dync2h1 UTSW 9 7,169,589 (GRCm39) missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7,162,925 (GRCm39) missense probably benign 0.25
R2020:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2024:Dync2h1 UTSW 9 7,129,062 (GRCm39) missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6,967,226 (GRCm39) missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7,160,171 (GRCm39) missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7,162,802 (GRCm39) missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7,148,735 (GRCm39) missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7,175,289 (GRCm39) missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7,011,253 (GRCm39) missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7,124,797 (GRCm39) missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7,037,828 (GRCm39) splice site probably null
R2255:Dync2h1 UTSW 9 6,955,905 (GRCm39) critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7,081,053 (GRCm39) missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7,122,618 (GRCm39) missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7,144,246 (GRCm39) missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7,102,329 (GRCm39) missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7,049,114 (GRCm39) missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7,011,236 (GRCm39) missense probably benign
R3719:Dync2h1 UTSW 9 7,006,882 (GRCm39) splice site probably benign
R3723:Dync2h1 UTSW 9 7,041,658 (GRCm39) missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7,101,525 (GRCm39) missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6,935,293 (GRCm39) missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7,001,482 (GRCm39) missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7,124,825 (GRCm39) missense probably benign
R3950:Dync2h1 UTSW 9 7,112,061 (GRCm39) nonsense probably null
R4004:Dync2h1 UTSW 9 7,117,404 (GRCm39) missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7,131,881 (GRCm39) missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7,134,360 (GRCm39) missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7,077,880 (GRCm39) missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6,983,477 (GRCm39) missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7,085,009 (GRCm39) nonsense probably null
R4596:Dync2h1 UTSW 9 6,992,595 (GRCm39) missense probably benign
R4604:Dync2h1 UTSW 9 7,140,995 (GRCm39) missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7,051,411 (GRCm39) missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7,169,640 (GRCm39) missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7,118,932 (GRCm39) missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7,142,648 (GRCm39) critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7,006,862 (GRCm39) missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7,139,422 (GRCm39) missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7,134,364 (GRCm39) missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7,147,717 (GRCm39) missense probably benign
R4899:Dync2h1 UTSW 9 7,131,921 (GRCm39) nonsense probably null
R4971:Dync2h1 UTSW 9 7,131,949 (GRCm39) missense probably benign
R5040:Dync2h1 UTSW 9 6,992,625 (GRCm39) missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7,085,007 (GRCm39) missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7,116,540 (GRCm39) missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7,155,099 (GRCm39) missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7,129,727 (GRCm39) missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7,176,962 (GRCm39) unclassified probably benign
R5384:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7,120,899 (GRCm39) nonsense probably null
R5402:Dync2h1 UTSW 9 7,114,949 (GRCm39) missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7,144,217 (GRCm39) missense probably benign
R5538:Dync2h1 UTSW 9 7,168,630 (GRCm39) intron probably benign
R5551:Dync2h1 UTSW 9 7,031,718 (GRCm39) missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7,118,885 (GRCm39) missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7,120,909 (GRCm39) missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7,116,638 (GRCm39) missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7,169,689 (GRCm39) missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7,169,528 (GRCm39) missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7,165,762 (GRCm39) missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6,996,905 (GRCm39) missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7,148,717 (GRCm39) missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7,102,309 (GRCm39) critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7,037,801 (GRCm39) missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7,117,466 (GRCm39) nonsense probably null
R5982:Dync2h1 UTSW 9 6,955,986 (GRCm39) missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7,157,646 (GRCm39) missense probably benign
R6125:Dync2h1 UTSW 9 7,168,706 (GRCm39) missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7,165,677 (GRCm39) missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7,135,078 (GRCm39) missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7,084,986 (GRCm39) missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7,165,717 (GRCm39) missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7,165,703 (GRCm39) missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7,168,331 (GRCm39) missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7,159,478 (GRCm39) splice site probably null
R6554:Dync2h1 UTSW 9 7,037,699 (GRCm39) missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7,139,501 (GRCm39) missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7,120,819 (GRCm39) missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7,041,718 (GRCm39) missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7,159,632 (GRCm39) missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7,131,855 (GRCm39) missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7,102,549 (GRCm39) missense probably benign
R6997:Dync2h1 UTSW 9 7,168,743 (GRCm39) missense probably null 0.00
R7084:Dync2h1 UTSW 9 7,113,214 (GRCm39) missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7,075,788 (GRCm39) missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7,075,786 (GRCm39) missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7,050,479 (GRCm39) missense probably benign
R7196:Dync2h1 UTSW 9 7,147,715 (GRCm39) nonsense probably null
R7208:Dync2h1 UTSW 9 7,141,059 (GRCm39) missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7,142,756 (GRCm39) missense probably benign
R7237:Dync2h1 UTSW 9 6,993,966 (GRCm39) missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7,102,405 (GRCm39) missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6,929,590 (GRCm39) missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7,001,454 (GRCm39) missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7,011,247 (GRCm39) missense probably benign
R7351:Dync2h1 UTSW 9 7,167,145 (GRCm39) missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7,159,479 (GRCm39) critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7,157,932 (GRCm39) missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7,041,720 (GRCm39) missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7,132,041 (GRCm39) missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7,124,855 (GRCm39) missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7,135,015 (GRCm39) splice site probably null
R7501:Dync2h1 UTSW 9 7,175,336 (GRCm39) missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7,002,623 (GRCm39) missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7,101,111 (GRCm39) missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7,141,254 (GRCm39) missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7,117,570 (GRCm39) missense probably benign
R7654:Dync2h1 UTSW 9 7,122,664 (GRCm39) missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7,076,232 (GRCm39) missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7,015,490 (GRCm39) missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7,129,719 (GRCm39) missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7,114,914 (GRCm39) missense probably damaging 0.96
R7834:Dync2h1 UTSW 9 7,118,953 (GRCm39) missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7,005,566 (GRCm39) missense possibly damaging 0.80
R7952:Dync2h1 UTSW 9 7,129,802 (GRCm39) missense possibly damaging 0.63
R8111:Dync2h1 UTSW 9 7,148,688 (GRCm39) missense probably benign 0.03
R8166:Dync2h1 UTSW 9 7,129,089 (GRCm39) nonsense probably null
R8236:Dync2h1 UTSW 9 7,080,363 (GRCm39) intron probably benign
R8326:Dync2h1 UTSW 9 7,147,771 (GRCm39) missense probably benign
R8335:Dync2h1 UTSW 9 7,084,941 (GRCm39) missense probably benign 0.28
R8347:Dync2h1 UTSW 9 7,116,578 (GRCm39) missense possibly damaging 0.81
R8372:Dync2h1 UTSW 9 7,111,514 (GRCm39) missense possibly damaging 0.90
R8421:Dync2h1 UTSW 9 7,102,477 (GRCm39) missense probably damaging 1.00
R8518:Dync2h1 UTSW 9 7,051,452 (GRCm39) missense probably benign 0.04
R8556:Dync2h1 UTSW 9 7,113,198 (GRCm39) missense probably benign 0.32
R8690:Dync2h1 UTSW 9 7,075,824 (GRCm39) missense probably damaging 1.00
R8713:Dync2h1 UTSW 9 7,141,008 (GRCm39) nonsense probably null
R8719:Dync2h1 UTSW 9 7,041,641 (GRCm39) missense probably benign 0.05
R8732:Dync2h1 UTSW 9 7,168,326 (GRCm39) missense probably damaging 1.00
R8744:Dync2h1 UTSW 9 7,011,220 (GRCm39) nonsense probably null
R8749:Dync2h1 UTSW 9 7,035,063 (GRCm39) missense probably benign 0.32
R8795:Dync2h1 UTSW 9 7,137,087 (GRCm39) missense probably benign 0.00
R8853:Dync2h1 UTSW 9 7,117,645 (GRCm39) missense possibly damaging 0.94
R8923:Dync2h1 UTSW 9 7,168,515 (GRCm39) missense probably benign
R8969:Dync2h1 UTSW 9 7,130,723 (GRCm39) missense probably damaging 1.00
R8988:Dync2h1 UTSW 9 7,037,727 (GRCm39) missense probably benign 0.00
R8997:Dync2h1 UTSW 9 7,129,003 (GRCm39) missense probably benign
R9025:Dync2h1 UTSW 9 7,139,462 (GRCm39) nonsense probably null
R9036:Dync2h1 UTSW 9 7,051,495 (GRCm39) missense probably damaging 1.00
R9055:Dync2h1 UTSW 9 6,996,641 (GRCm39) intron probably benign
R9165:Dync2h1 UTSW 9 7,114,883 (GRCm39) missense probably damaging 0.99
R9172:Dync2h1 UTSW 9 7,031,771 (GRCm39) missense probably damaging 1.00
R9286:Dync2h1 UTSW 9 6,941,668 (GRCm39) missense probably benign 0.01
R9312:Dync2h1 UTSW 9 7,050,413 (GRCm39) missense probably damaging 1.00
R9335:Dync2h1 UTSW 9 7,112,149 (GRCm39) missense possibly damaging 0.88
R9344:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R9351:Dync2h1 UTSW 9 7,176,911 (GRCm39) missense probably damaging 0.98
R9367:Dync2h1 UTSW 9 7,125,730 (GRCm39) critical splice donor site probably null
R9613:Dync2h1 UTSW 9 7,075,769 (GRCm39) missense probably damaging 0.99
R9650:Dync2h1 UTSW 9 7,174,849 (GRCm39) missense possibly damaging 0.83
R9726:Dync2h1 UTSW 9 7,077,999 (GRCm39) missense possibly damaging 0.94
R9731:Dync2h1 UTSW 9 7,141,166 (GRCm39) missense probably benign
X0009:Dync2h1 UTSW 9 7,117,576 (GRCm39) missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7,168,730 (GRCm39) frame shift probably null
Z1176:Dync2h1 UTSW 9 7,142,361 (GRCm39) missense probably damaging 0.99
Z1177:Dync2h1 UTSW 9 7,102,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGACCACACCTTTAAGTAC -3'
(R):5'- GAATTATTTGGTGCAAGTCGTAAGG -3'

Sequencing Primer
(F):5'- CAGGCAGCATGAAACCAT -3'
(R):5'- GAAAACTACATTGAGCATTTGG -3'
Posted On 2020-06-30