Incidental Mutation 'R8157:Ccdc15'
ID633077
Institutional Source Beutler Lab
Gene Symbol Ccdc15
Ensembl Gene ENSMUSG00000034303
Gene Namecoiled-coil domain containing 15
SynonymsA630039F14Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081429; MGI: 2444488

Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R8157 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37275835-37348432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37315457 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 407 (G407D)
Ref Sequence ENSEMBL: ENSMUSP00000036784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037275] [ENSMUST00000213633] [ENSMUST00000215116]
Predicted Effect probably benign
Transcript: ENSMUST00000037275
AA Change: G407D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036784
Gene: ENSMUSG00000034303
AA Change: G407D

DomainStartEndE-ValueType
low complexity region 80 92 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
coiled coil region 173 202 N/A INTRINSIC
coiled coil region 652 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213633
AA Change: G394D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215116
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T A 10: 80,319,527 R51W probably damaging Het
3110002H16Rik T C 18: 12,188,633 V497A possibly damaging Het
Adam3 A G 8: 24,707,437 I326T probably benign Het
Alpk3 A G 7: 81,093,722 K1096E probably benign Het
Aph1a T C 3: 95,894,838 V44A possibly damaging Het
Ash1l T A 3: 89,063,707 probably null Het
Atg2b A G 12: 105,662,940 M410T probably damaging Het
Cd200r4 T A 16: 44,833,141 N137K probably damaging Het
Clec18a A G 8: 111,072,051 L438P probably damaging Het
Clip1 A G 5: 123,630,719 S606P probably benign Het
Col11a2 G A 17: 34,061,256 G1193E unknown Het
Col6a4 A G 9: 106,067,898 S1006P possibly damaging Het
Ctsc A T 7: 88,302,208 D221V probably benign Het
Ctse T C 1: 131,672,511 Y333H probably damaging Het
Cyp2c23 T C 19: 44,021,627 N93S probably benign Het
Daam1 A T 12: 71,952,489 D633V probably damaging Het
Dlg2 G A 7: 92,386,932 R607H probably damaging Het
Dsg2 T A 18: 20,580,549 D192E probably damaging Het
Dync2h1 A T 9: 7,001,473 N3838K possibly damaging Het
Ephx2 A C 14: 66,108,057 S153A probably damaging Het
Eprs C A 1: 185,398,394 H651N probably benign Het
Fat2 T C 11: 55,252,084 D4313G possibly damaging Het
Fras1 A G 5: 96,554,855 K252R probably benign Het
Galt A T 4: 41,757,226 Q193L probably benign Het
Gatsl2 T C 5: 134,137,097 F228S possibly damaging Het
Gm21964 A G 8: 110,108,861 M24V probably benign Het
Gm7356 T C 17: 14,001,321 K149E probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd1 T A 12: 51,791,290 R696S possibly damaging Het
Hydin A G 8: 110,452,036 I1088V probably benign Het
Igkv4-68 A T 6: 69,305,322 S14R probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lrit3 T C 3: 129,800,635 T98A probably benign Het
Macc1 A G 12: 119,445,993 I165M probably benign Het
Mapre2 T A 18: 23,858,161 M162K probably benign Het
Mzf1 T A 7: 13,044,352 H454L probably damaging Het
Naa30 T A 14: 49,173,408 N264K probably benign Het
Olfr199 A G 16: 59,215,989 V208A probably benign Het
Olfr924 T A 9: 38,848,466 Y117* probably null Het
Osr2 T C 15: 35,301,917 I221T probably benign Het
Pcdh12 A T 18: 38,282,797 I425K probably benign Het
Pcdhb3 T G 18: 37,303,239 Y753D probably damaging Het
Pcdhb9 T A 18: 37,403,155 V734E probably damaging Het
Pibf1 T A 14: 99,196,395 L593I probably benign Het
Ppp1r32 A T 19: 10,478,265 F207I probably damaging Het
Prag1 G A 8: 36,147,239 C1315Y probably damaging Het
Prl3c1 T C 13: 27,199,347 S19P probably damaging Het
Ptprz1 A T 6: 23,002,540 D1543V probably damaging Het
Ripor2 A G 13: 24,695,617 N356S probably benign Het
Scrib T C 15: 76,059,188 H914R possibly damaging Het
Sema6b G A 17: 56,128,448 A265V probably damaging Het
Tdrd9 C G 12: 111,985,066 L97V probably benign Het
Trabd T A 15: 89,085,821 L340H probably damaging Het
Trpm1 T C 7: 64,199,269 W88R probably damaging Het
Txndc12 G T 4: 108,853,222 probably null Het
Vmn1r175 T C 7: 23,809,098 I35V probably benign Het
Vmn1r48 A T 6: 90,036,012 V277E probably damaging Het
Vmn2r72 G A 7: 85,751,233 H203Y probably benign Het
Zbtb7c A G 18: 76,137,327 E162G probably benign Het
Zfp93 T A 7: 24,276,460 C623* probably null Het
Zzz3 A G 3: 152,449,648 I645V probably null Het
Other mutations in Ccdc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccdc15 APN 9 37320473 missense probably damaging 1.00
IGL00823:Ccdc15 APN 9 37320413 missense probably benign 0.01
IGL00979:Ccdc15 APN 9 37316490 missense probably benign 0.44
IGL01380:Ccdc15 APN 9 37276557 utr 3 prime probably benign
IGL01832:Ccdc15 APN 9 37311344 missense probably damaging 0.97
IGL01845:Ccdc15 APN 9 37315236 nonsense probably null
IGL02375:Ccdc15 APN 9 37304332 missense probably damaging 0.99
F6893:Ccdc15 UTSW 9 37315640 missense probably damaging 0.97
FR4304:Ccdc15 UTSW 9 37315157 frame shift probably null
FR4449:Ccdc15 UTSW 9 37315158 frame shift probably null
R1743:Ccdc15 UTSW 9 37277477 nonsense probably null
R1848:Ccdc15 UTSW 9 37342570 missense probably benign 0.00
R1968:Ccdc15 UTSW 9 37347795 missense probably benign 0.05
R2006:Ccdc15 UTSW 9 37315472 missense possibly damaging 0.91
R2372:Ccdc15 UTSW 9 37315505 missense possibly damaging 0.64
R2932:Ccdc15 UTSW 9 37315658 missense probably benign 0.00
R3962:Ccdc15 UTSW 9 37320486 missense probably damaging 1.00
R5585:Ccdc15 UTSW 9 37277403 missense probably benign 0.00
R5919:Ccdc15 UTSW 9 37320396 critical splice donor site probably null
R6000:Ccdc15 UTSW 9 37315764 missense probably benign 0.00
R6198:Ccdc15 UTSW 9 37314285 critical splice donor site probably null
R6476:Ccdc15 UTSW 9 37342419 missense probably benign 0.04
R7098:Ccdc15 UTSW 9 37343960 missense probably damaging 1.00
R7485:Ccdc15 UTSW 9 37315278 missense probably benign
R7548:Ccdc15 UTSW 9 37277427 missense probably benign 0.45
R7627:Ccdc15 UTSW 9 37342402 missense unknown
R7807:Ccdc15 UTSW 9 37315382 missense probably benign 0.07
R8230:Ccdc15 UTSW 9 37315259 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACATGTGGCTCTCTTTGGTC -3'
(R):5'- GTGTCAGACTACAGAGCCAG -3'

Sequencing Primer
(F):5'- TGGTGTCTCAGCAGCAGG -3'
(R):5'- CCAGAAGGCCAGGCTGTTAAG -3'
Posted On2020-06-30