Mutagenetix > Incidental Mutation

Incidental Mutation 'R8157:Col6a4'

633079

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

067583-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8157 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106067898 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1006 (S1006P)

Ref Sequence

ENSEMBL: ENSMUSP00000112472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

AlphaFold

A2AX52

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121963
AA Change: S1006P

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: S1006P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310011J03Rik	T	A	10: 80,319,527	R51W	probably damaging	Het
3110002H16Rik	T	C	18: 12,188,633	V497A	possibly damaging	Het
Adam3	A	G	8: 24,707,437	I326T	probably benign	Het
Alpk3	A	G	7: 81,093,722	K1096E	probably benign	Het
Aph1a	T	C	3: 95,894,838	V44A	possibly damaging	Het
Ash1l	T	A	3: 89,063,707		probably null	Het
Atg2b	A	G	12: 105,662,940	M410T	probably damaging	Het
Ccdc15	C	T	9: 37,315,457	G407D	probably benign	Het
Cd200r4	T	A	16: 44,833,141	N137K	probably damaging	Het
Clec18a	A	G	8: 111,072,051	L438P	probably damaging	Het
Clip1	A	G	5: 123,630,719	S606P	probably benign	Het
Col11a2	G	A	17: 34,061,256	G1193E	unknown	Het
Ctsc	A	T	7: 88,302,208	D221V	probably benign	Het
Ctse	T	C	1: 131,672,511	Y333H	probably damaging	Het
Cyp2c23	T	C	19: 44,021,627	N93S	probably benign	Het
Daam1	A	T	12: 71,952,489	D633V	probably damaging	Het
Dlg2	G	A	7: 92,386,932	R607H	probably damaging	Het
Dsg2	T	A	18: 20,580,549	D192E	probably damaging	Het
Dync2h1	A	T	9: 7,001,473	N3838K	possibly damaging	Het
Ephx2	A	C	14: 66,108,057	S153A	probably damaging	Het
Eprs	C	A	1: 185,398,394	H651N	probably benign	Het
Fat2	T	C	11: 55,252,084	D4313G	possibly damaging	Het
Fras1	A	G	5: 96,554,855	K252R	probably benign	Het
Galt	A	T	4: 41,757,226	Q193L	probably benign	Het
Gatsl2	T	C	5: 134,137,097	F228S	possibly damaging	Het
Gm21964	A	G	8: 110,108,861	M24V	probably benign	Het
Gm7356	T	C	17: 14,001,321	K149E	probably damaging	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Hectd1	T	A	12: 51,791,290	R696S	possibly damaging	Het
Hydin	A	G	8: 110,452,036	I1088V	probably benign	Het
Igkv4-68	A	T	6: 69,305,322	S14R	probably benign	Het
Lamb2	C	T	9: 108,480,646	R123W	probably damaging	Het
Ldlrad4	C	T	18: 68,254,222	R202*	probably null	Het
Lrit3	T	C	3: 129,800,635	T98A	probably benign	Het
Macc1	A	G	12: 119,445,993	I165M	probably benign	Het
Mapre2	T	A	18: 23,858,161	M162K	probably benign	Het
Mzf1	T	A	7: 13,044,352	H454L	probably damaging	Het
Naa30	T	A	14: 49,173,408	N264K	probably benign	Het
Olfr199	A	G	16: 59,215,989	V208A	probably benign	Het
Olfr924	T	A	9: 38,848,466	Y117*	probably null	Het
Osr2	T	C	15: 35,301,917	I221T	probably benign	Het
Pcdh12	A	T	18: 38,282,797	I425K	probably benign	Het
Pcdhb3	T	G	18: 37,303,239	Y753D	probably damaging	Het
Pcdhb9	T	A	18: 37,403,155	V734E	probably damaging	Het
Pibf1	T	A	14: 99,196,395	L593I	probably benign	Het
Ppp1r32	A	T	19: 10,478,265	F207I	probably damaging	Het
Prag1	G	A	8: 36,147,239	C1315Y	probably damaging	Het
Prl3c1	T	C	13: 27,199,347	S19P	probably damaging	Het
Ptprz1	A	T	6: 23,002,540	D1543V	probably damaging	Het
Ripor2	A	G	13: 24,695,617	N356S	probably benign	Het
Scrib	T	C	15: 76,059,188	H914R	possibly damaging	Het
Sema6b	G	A	17: 56,128,448	A265V	probably damaging	Het
Tdrd9	C	G	12: 111,985,066	L97V	probably benign	Het
Trabd	T	A	15: 89,085,821	L340H	probably damaging	Het
Trpm1	T	C	7: 64,199,269	W88R	probably damaging	Het
Txndc12	G	T	4: 108,853,222		probably null	Het
Vmn1r175	T	C	7: 23,809,098	I35V	probably benign	Het
Vmn1r48	A	T	6: 90,036,012	V277E	probably damaging	Het
Vmn2r72	G	A	7: 85,751,233	H203Y	probably benign	Het
Zbtb7c	A	G	18: 76,137,327	E162G	probably benign	Het
Zfp93	T	A	7: 24,276,460	C623*	probably null	Het
Zzz3	A	G	3: 152,449,648	I645V	probably null	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2174:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R2568:Col6a4	UTSW	9	106063076	missense	possibly damaging	0.90
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R4998:Col6a4	UTSW	9	105990778	utr 3 prime	probably benign
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5929:Col6a4	UTSW	9	106063044	missense	probably benign	0.15
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6490:Col6a4	UTSW	9	106074992	nonsense	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R6944:Col6a4	UTSW	9	106072171	missense	probably damaging	0.98
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7335:Col6a4	UTSW	9	106076892	missense	possibly damaging	0.90
R7418:Col6a4	UTSW	9	106022915	missense	probably damaging	1.00
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R8292:Col6a4	UTSW	9	106076877	missense	probably benign	0.01
R8309:Col6a4	UTSW	9	106075215	missense	probably benign	0.08
R8336:Col6a4	UTSW	9	106075329	missense	possibly damaging	0.65
R8359:Col6a4	UTSW	9	106068384	missense	probably benign	0.00
R8530:Col6a4	UTSW	9	106080505	missense	probably benign	0.31
R8556:Col6a4	UTSW	9	106067053	missense	probably damaging	0.96
R8832:Col6a4	UTSW	9	106072154	missense	probably benign
R9001:Col6a4	UTSW	9	106067171	missense	probably benign	0.26
R9009:Col6a4	UTSW	9	106077205	missense	probably benign	0.38
R9069:Col6a4	UTSW	9	106074939	missense	possibly damaging	0.85
R9155:Col6a4	UTSW	9	106075010	missense	probably benign
R9175:Col6a4	UTSW	9	106080361	missense	probably benign
R9176:Col6a4	UTSW	9	106061556	missense	probably damaging	1.00
R9295:Col6a4	UTSW	9	106080535	missense	probably damaging	1.00
R9298:Col6a4	UTSW	9	106068335	missense	probably damaging	0.96
R9389:Col6a4	UTSW	9	106000784	missense	probably damaging	1.00
R9424:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
R9576:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCACTGGGTTGCAAACAGAG -3'
(R):5'- CGTTGCCCGATACCTCATTG -3'

Sequencing Primer
(F):5'- CACTGGGTTGCAAACAGAGGAAAAG -3'
(R):5'- GATACCTCATTGTCATCACTGATGG -3'

Posted On

2020-06-30