Incidental Mutation 'R8157:Ripor2'
ID633088
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R8157 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24695617 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 356 (N356S)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
Predicted Effect probably benign
Transcript: ENSMUST00000038477
AA Change: N356S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: N356S

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058009
AA Change: N356S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: N356S

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091694
AA Change: N359S

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: N359S

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110383
AA Change: N331S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: N331S

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110384
AA Change: N356S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: N356S

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T A 10: 80,319,527 R51W probably damaging Het
3110002H16Rik T C 18: 12,188,633 V497A possibly damaging Het
Adam3 A G 8: 24,707,437 I326T probably benign Het
Alpk3 A G 7: 81,093,722 K1096E probably benign Het
Aph1a T C 3: 95,894,838 V44A possibly damaging Het
Ash1l T A 3: 89,063,707 probably null Het
Atg2b A G 12: 105,662,940 M410T probably damaging Het
Ccdc15 C T 9: 37,315,457 G407D probably benign Het
Cd200r4 T A 16: 44,833,141 N137K probably damaging Het
Clec18a A G 8: 111,072,051 L438P probably damaging Het
Clip1 A G 5: 123,630,719 S606P probably benign Het
Col11a2 G A 17: 34,061,256 G1193E unknown Het
Col6a4 A G 9: 106,067,898 S1006P possibly damaging Het
Ctsc A T 7: 88,302,208 D221V probably benign Het
Ctse T C 1: 131,672,511 Y333H probably damaging Het
Cyp2c23 T C 19: 44,021,627 N93S probably benign Het
Daam1 A T 12: 71,952,489 D633V probably damaging Het
Dlg2 G A 7: 92,386,932 R607H probably damaging Het
Dsg2 T A 18: 20,580,549 D192E probably damaging Het
Dync2h1 A T 9: 7,001,473 N3838K possibly damaging Het
Ephx2 A C 14: 66,108,057 S153A probably damaging Het
Eprs C A 1: 185,398,394 H651N probably benign Het
Fat2 T C 11: 55,252,084 D4313G possibly damaging Het
Fras1 A G 5: 96,554,855 K252R probably benign Het
Galt A T 4: 41,757,226 Q193L probably benign Het
Gatsl2 T C 5: 134,137,097 F228S possibly damaging Het
Gm21964 A G 8: 110,108,861 M24V probably benign Het
Gm7356 T C 17: 14,001,321 K149E probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd1 T A 12: 51,791,290 R696S possibly damaging Het
Hydin A G 8: 110,452,036 I1088V probably benign Het
Igkv4-68 A T 6: 69,305,322 S14R probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lrit3 T C 3: 129,800,635 T98A probably benign Het
Macc1 A G 12: 119,445,993 I165M probably benign Het
Mapre2 T A 18: 23,858,161 M162K probably benign Het
Mzf1 T A 7: 13,044,352 H454L probably damaging Het
Naa30 T A 14: 49,173,408 N264K probably benign Het
Olfr199 A G 16: 59,215,989 V208A probably benign Het
Olfr924 T A 9: 38,848,466 Y117* probably null Het
Osr2 T C 15: 35,301,917 I221T probably benign Het
Pcdh12 A T 18: 38,282,797 I425K probably benign Het
Pcdhb3 T G 18: 37,303,239 Y753D probably damaging Het
Pcdhb9 T A 18: 37,403,155 V734E probably damaging Het
Pibf1 T A 14: 99,196,395 L593I probably benign Het
Ppp1r32 A T 19: 10,478,265 F207I probably damaging Het
Prag1 G A 8: 36,147,239 C1315Y probably damaging Het
Prl3c1 T C 13: 27,199,347 S19P probably damaging Het
Ptprz1 A T 6: 23,002,540 D1543V probably damaging Het
Scrib T C 15: 76,059,188 H914R possibly damaging Het
Sema6b G A 17: 56,128,448 A265V probably damaging Het
Tdrd9 C G 12: 111,985,066 L97V probably benign Het
Trabd T A 15: 89,085,821 L340H probably damaging Het
Trpm1 T C 7: 64,199,269 W88R probably damaging Het
Txndc12 G T 4: 108,853,222 probably null Het
Vmn1r175 T C 7: 23,809,098 I35V probably benign Het
Vmn1r48 A T 6: 90,036,012 V277E probably damaging Het
Vmn2r72 G A 7: 85,751,233 H203Y probably benign Het
Zbtb7c A G 18: 76,137,327 E162G probably benign Het
Zfp93 T A 7: 24,276,460 C623* probably null Het
Zzz3 A G 3: 152,449,648 I645V probably null Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24713700 missense probably benign 0.01
R8364:Ripor2 UTSW 13 24710193 missense possibly damaging 0.95
R8447:Ripor2 UTSW 13 24723788 missense probably damaging 1.00
R8465:Ripor2 UTSW 13 24665468 intron probably benign
R8751:Ripor2 UTSW 13 24701067 missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24717668 missense not run
Predicted Primers PCR Primer
(F):5'- GAGTCAGTCTTCTGCTGCAC -3'
(R):5'- AAAGTCTCTGATGTGGGTGATACAC -3'

Sequencing Primer
(F):5'- TCTGATAACCCAGGTTGGTCCAAAG -3'
(R):5'- GTGGGTGATACACAACTTCAAATTC -3'
Posted On2020-06-30