Incidental Mutation 'R0102:Cyp2d10'
Institutional Source Beutler Lab
Gene Symbol Cyp2d10
Ensembl Gene ENSMUSG00000094806
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 10
SynonymsCyp2d, P450-2D
MMRRC Submission 038388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0102 (G1)
Quality Score216
Status Validated
Chromosomal Location82402846-82407195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82404593 bp
Amino Acid Change Methionine to Isoleucine at position 229 (M229I)
Ref Sequence ENSEMBL: ENSMUSP00000155626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072776] [ENSMUST00000229628] [ENSMUST00000229911] [ENSMUST00000230198] [ENSMUST00000230248] [ENSMUST00000230843]
Predicted Effect probably benign
Transcript: ENSMUST00000072776
AA Change: M229I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072555
Gene: ENSMUSG00000094806
AA Change: M229I

transmembrane domain 4 26 N/A INTRINSIC
Pfam:p450 37 497 6e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183705
Predicted Effect probably benign
Transcript: ENSMUST00000229628
Predicted Effect probably benign
Transcript: ENSMUST00000229911
Predicted Effect probably benign
Transcript: ENSMUST00000230198
AA Change: M229I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000230248
Predicted Effect probably benign
Transcript: ENSMUST00000230843
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,113 K1021R probably damaging Het
2610528J11Rik G A 4: 118,529,565 V36M probably damaging Het
4930402F06Rik T A 2: 35,375,783 R292* probably null Het
Abcb4 T C 5: 8,909,194 F207S probably damaging Het
Afap1l2 G T 19: 56,928,440 probably benign Het
Arfgef2 A T 2: 166,845,465 H203L probably benign Het
Cfi A C 3: 129,848,767 H90P probably damaging Het
Col1a2 T A 6: 4,520,775 S371T possibly damaging Het
Dnah5 A G 15: 28,245,751 probably benign Het
Dnttip2 G T 3: 122,275,803 M222I probably benign Het
Dync1li2 A T 8: 104,428,125 Y284N probably benign Het
Ebf1 T C 11: 44,991,455 Y413H probably benign Het
Exog A G 9: 119,452,253 T186A possibly damaging Het
Fam171a2 T C 11: 102,444,113 N66S possibly damaging Het
Gad1 G A 2: 70,587,239 probably null Het
Golgb1 C A 16: 36,875,468 probably benign Het
Gprc5a A T 6: 135,079,035 N160I probably damaging Het
Haus3 A G 5: 34,165,914 probably null Het
Klhl20 A T 1: 161,090,445 C90* probably null Het
Krt84 T A 15: 101,528,703 I342L probably damaging Het
Lifr G A 15: 7,178,892 D584N probably damaging Het
Lrp1b G A 2: 41,408,985 probably benign Het
Lrtm1 T A 14: 29,022,227 probably benign Het
Med25 C T 7: 44,885,480 V80I possibly damaging Het
Mest A G 6: 30,746,270 I279V probably damaging Het
Mki67 T C 7: 135,713,803 R81G probably benign Het
Naa25 A G 5: 121,435,569 D787G possibly damaging Het
Naaladl1 C T 19: 6,112,504 P465S probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Necab3 G A 2: 154,545,312 R302C probably damaging Het
Nsg1 A T 5: 38,158,910 D32E probably damaging Het
Nuggc A G 14: 65,613,551 D290G probably null Het
Nup205 A T 6: 35,225,780 probably benign Het
Olfr1100 A T 2: 86,978,205 I197N possibly damaging Het
Olfr1216 T C 2: 89,013,671 Y131C probably damaging Het
Olfr1250 T C 2: 89,656,655 N262S probably benign Het
Olfr1308 G C 2: 111,960,597 Q159E probably damaging Het
Olfr1361 T C 13: 21,658,735 D196G probably damaging Het
Olfr743 T A 14: 50,533,631 L73Q probably damaging Het
Otp T C 13: 94,877,155 V27A probably benign Het
Phip A T 9: 82,905,792 probably null Het
Pon2 A G 6: 5,289,091 probably benign Het
Ppp1r12b T A 1: 134,835,899 probably null Het
Ppp1r15b A G 1: 133,133,170 N475S probably damaging Het
Prrt3 A T 6: 113,497,829 L144H probably damaging Het
Psmb7 A G 2: 38,643,365 V50A possibly damaging Het
Sacs T A 14: 61,204,568 S1354R probably damaging Het
Sdcbp2 A G 2: 151,583,964 T29A probably benign Het
Shbg T A 11: 69,617,589 probably benign Het
Shcbp1 A G 8: 4,744,452 I447T probably damaging Het
Tbc1d9b T C 11: 50,135,849 V48A probably damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trappc12 A T 12: 28,746,752 F260L probably damaging Het
Trim10 C A 17: 36,870,182 H102N probably damaging Het
Ube2u A G 4: 100,549,925 T215A possibly damaging Het
Vcan T G 13: 89,703,668 T1058P probably benign Het
Other mutations in Cyp2d10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Cyp2d10 APN 15 82403314 missense possibly damaging 0.71
IGL00840:Cyp2d10 APN 15 82404490 missense probably benign 0.40
IGL01293:Cyp2d10 APN 15 82403009 missense possibly damaging 0.92
IGL01339:Cyp2d10 APN 15 82403841 missense probably benign 0.33
IGL01871:Cyp2d10 APN 15 82403885 missense probably damaging 1.00
IGL02132:Cyp2d10 APN 15 82404607 intron probably benign
IGL02713:Cyp2d10 APN 15 82406082 unclassified probably benign
IGL02869:Cyp2d10 APN 15 82403868 missense possibly damaging 0.84
R0102:Cyp2d10 UTSW 15 82404593 missense probably benign 0.01
R0279:Cyp2d10 UTSW 15 82405339 missense possibly damaging 0.94
R0331:Cyp2d10 UTSW 15 82407026 missense probably benign 0.12
R1344:Cyp2d10 UTSW 15 82405905 critical splice donor site probably null
R1418:Cyp2d10 UTSW 15 82405905 critical splice donor site probably null
R1465:Cyp2d10 UTSW 15 82403928 splice site probably null
R1465:Cyp2d10 UTSW 15 82403928 splice site probably null
R1706:Cyp2d10 UTSW 15 82405582 missense probably damaging 0.96
R1712:Cyp2d10 UTSW 15 82403039 missense probably damaging 1.00
R1940:Cyp2d10 UTSW 15 82405294 missense probably benign 0.13
R1983:Cyp2d10 UTSW 15 82405999 missense probably benign 0.15
R2056:Cyp2d10 UTSW 15 82403814 missense probably damaging 1.00
R2058:Cyp2d10 UTSW 15 82403814 missense probably damaging 1.00
R3707:Cyp2d10 UTSW 15 82403016 missense possibly damaging 0.91
R3708:Cyp2d10 UTSW 15 82403016 missense possibly damaging 0.91
R4042:Cyp2d10 UTSW 15 82406068 missense probably benign 0.33
R4531:Cyp2d10 UTSW 15 82405261 missense probably benign 0.31
R4694:Cyp2d10 UTSW 15 82404483 missense probably damaging 1.00
R4869:Cyp2d10 UTSW 15 82403766 missense probably benign 0.00
R5071:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5072:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5073:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5074:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5746:Cyp2d10 UTSW 15 82405271 missense probably benign 0.38
R7096:Cyp2d10 UTSW 15 82405261 missense probably benign
R7212:Cyp2d10 UTSW 15 82404246 critical splice acceptor site probably null
R7324:Cyp2d10 UTSW 15 82403760 missense probably damaging 0.97
R7487:Cyp2d10 UTSW 15 82404592 missense probably benign 0.00
R7915:Cyp2d10 UTSW 15 82404427 critical splice donor site probably null
X0063:Cyp2d10 UTSW 15 82406000 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- caaatggtgggtgggtaagg -3'
Posted On2013-07-30