Incidental Mutation 'R8157:Pcdh12'
ID633106
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8157 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38282797 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 425 (I425K)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably benign
Transcript: ENSMUST00000025311
AA Change: I425K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: I425K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310011J03Rik T A 10: 80,319,527 R51W probably damaging Het
3110002H16Rik T C 18: 12,188,633 V497A possibly damaging Het
Adam3 A G 8: 24,707,437 I326T probably benign Het
Alpk3 A G 7: 81,093,722 K1096E probably benign Het
Aph1a T C 3: 95,894,838 V44A possibly damaging Het
Ash1l T A 3: 89,063,707 probably null Het
Atg2b A G 12: 105,662,940 M410T probably damaging Het
Ccdc15 C T 9: 37,315,457 G407D probably benign Het
Cd200r4 T A 16: 44,833,141 N137K probably damaging Het
Clec18a A G 8: 111,072,051 L438P probably damaging Het
Clip1 A G 5: 123,630,719 S606P probably benign Het
Col11a2 G A 17: 34,061,256 G1193E unknown Het
Col6a4 A G 9: 106,067,898 S1006P possibly damaging Het
Ctsc A T 7: 88,302,208 D221V probably benign Het
Ctse T C 1: 131,672,511 Y333H probably damaging Het
Cyp2c23 T C 19: 44,021,627 N93S probably benign Het
Daam1 A T 12: 71,952,489 D633V probably damaging Het
Dlg2 G A 7: 92,386,932 R607H probably damaging Het
Dsg2 T A 18: 20,580,549 D192E probably damaging Het
Dync2h1 A T 9: 7,001,473 N3838K possibly damaging Het
Ephx2 A C 14: 66,108,057 S153A probably damaging Het
Eprs C A 1: 185,398,394 H651N probably benign Het
Fat2 T C 11: 55,252,084 D4313G possibly damaging Het
Fras1 A G 5: 96,554,855 K252R probably benign Het
Galt A T 4: 41,757,226 Q193L probably benign Het
Gatsl2 T C 5: 134,137,097 F228S possibly damaging Het
Gm21964 A G 8: 110,108,861 M24V probably benign Het
Gm7356 T C 17: 14,001,321 K149E probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd1 T A 12: 51,791,290 R696S possibly damaging Het
Hydin A G 8: 110,452,036 I1088V probably benign Het
Igkv4-68 A T 6: 69,305,322 S14R probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Lrit3 T C 3: 129,800,635 T98A probably benign Het
Macc1 A G 12: 119,445,993 I165M probably benign Het
Mapre2 T A 18: 23,858,161 M162K probably benign Het
Mzf1 T A 7: 13,044,352 H454L probably damaging Het
Naa30 T A 14: 49,173,408 N264K probably benign Het
Olfr199 A G 16: 59,215,989 V208A probably benign Het
Olfr924 T A 9: 38,848,466 Y117* probably null Het
Osr2 T C 15: 35,301,917 I221T probably benign Het
Pcdhb3 T G 18: 37,303,239 Y753D probably damaging Het
Pcdhb9 T A 18: 37,403,155 V734E probably damaging Het
Pibf1 T A 14: 99,196,395 L593I probably benign Het
Ppp1r32 A T 19: 10,478,265 F207I probably damaging Het
Prag1 G A 8: 36,147,239 C1315Y probably damaging Het
Prl3c1 T C 13: 27,199,347 S19P probably damaging Het
Ptprz1 A T 6: 23,002,540 D1543V probably damaging Het
Ripor2 A G 13: 24,695,617 N356S probably benign Het
Scrib T C 15: 76,059,188 H914R possibly damaging Het
Sema6b G A 17: 56,128,448 A265V probably damaging Het
Tdrd9 C G 12: 111,985,066 L97V probably benign Het
Trabd T A 15: 89,085,821 L340H probably damaging Het
Trpm1 T C 7: 64,199,269 W88R probably damaging Het
Txndc12 G T 4: 108,853,222 probably null Het
Vmn1r175 T C 7: 23,809,098 I35V probably benign Het
Vmn1r48 A T 6: 90,036,012 V277E probably damaging Het
Vmn2r72 G A 7: 85,751,233 H203Y probably benign Het
Zbtb7c A G 18: 76,137,327 E162G probably benign Het
Zfp93 T A 7: 24,276,460 C623* probably null Het
Zzz3 A G 3: 152,449,648 I645V probably null Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
R8103:Pcdh12 UTSW 18 38282159 missense probably damaging 1.00
R8322:Pcdh12 UTSW 18 38281577 nonsense probably null
R8503:Pcdh12 UTSW 18 38282521 missense possibly damaging 0.86
R8510:Pcdh12 UTSW 18 38282056 missense possibly damaging 0.89
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCATTACTGCCCAAGTCAGC -3'
(R):5'- TCGCTGGTGTCAGAAGATCTTC -3'

Sequencing Primer
(F):5'- GCATCATGCGCTTTGAGC -3'
(R):5'- GAAGATCTTCCCAGGGATAGCTTC -3'
Posted On2020-06-30