Incidental Mutation 'R8153:Fga'
ID633123
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R8153 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83030857 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 180 (S180P)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably damaging
Transcript: ENSMUST00000029630
AA Change: S180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: S180P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: S180P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: S180P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.2087 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,733 S287T probably benign Het
Abca15 T C 7: 120,400,589 S1429P probably damaging Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,834,463 probably null Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Cachd1 G T 4: 100,988,638 probably null Het
Cfap61 T C 2: 146,200,784 I1159T probably benign Het
Csf1 T A 3: 107,748,704 D337V probably damaging Het
Ddhd2 T A 8: 25,750,789 T251S probably benign Het
Dnah5 A G 15: 28,384,430 T3107A probably damaging Het
Dnph1 T C 17: 46,499,039 V169A probably benign Het
Ebf2 T C 14: 67,390,465 V303A probably damaging Het
Enpp3 A G 10: 24,809,879 F206S probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fpr-rs3 A G 17: 20,624,423 L152P probably damaging Het
Gen1 C A 12: 11,260,947 G95W probably damaging Het
Ggta1 T A 2: 35,423,321 T3S possibly damaging Het
Gm4884 T A 7: 41,043,158 C184S probably benign Het
Gm5580 A T 6: 116,552,007 I282F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsx2 T C 5: 75,077,055 S223P probably damaging Het
Hnf4g C T 3: 3,634,190 probably benign Het
Iqub A C 6: 24,450,790 Y603* probably null Het
Klhl22 A G 16: 17,792,550 N555S probably damaging Het
Lama5 T C 2: 180,187,931 D1928G probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Lamc2 CATCAGCTA CA 1: 153,124,104 probably null Het
Lgr4 T A 2: 110,000,300 F255I probably damaging Het
Lnx2 T C 5: 147,028,096 N439S probably benign Het
Lztr1 G T 16: 17,518,575 probably null Het
Nfkb2 G T 19: 46,308,016 R241L probably damaging Het
Nrcam T C 12: 44,584,972 F1103L probably benign Het
Olfr123 A G 17: 37,795,476 I11V probably benign Het
Olfr181 A G 16: 58,925,786 S262P possibly damaging Het
Olfr924 A G 9: 38,848,335 I74V possibly damaging Het
Olfr965 A G 9: 39,719,658 M144V possibly damaging Het
Otof C A 5: 30,388,735 A425S probably damaging Het
Parg T A 14: 32,262,820 L774H probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pcnx4 T A 12: 72,556,243 F426L probably benign Het
Pde5a T G 3: 122,852,576 S805R probably benign Het
Pde5a T A 3: 122,852,578 M806K probably damaging Het
Plekhh1 T C 12: 79,079,038 S1283P probably benign Het
Ppp1r12a A G 10: 108,162,442 K15E probably damaging Het
Prkdc A T 16: 15,664,244 M384L probably damaging Het
Ptchd4 A G 17: 42,503,896 D896G probably benign Het
Rsf1 GGC GGCTACGGCCGC 7: 97,579,906 probably benign Het
Slmap T C 14: 26,533,333 S65G probably benign Het
Snta1 C A 2: 154,380,802 L298F probably damaging Het
Soga3 G T 10: 29,148,239 E384* probably null Het
Sphkap T G 1: 83,278,009 N673T possibly damaging Het
St8sia5 T G 18: 77,253,111 probably null Het
Tgm6 T C 2: 130,145,055 V481A probably benign Het
Thada T C 17: 84,393,427 N1217S possibly damaging Het
Tia1 C G 6: 86,420,332 H107D probably damaging Het
Ttn A G 2: 76,916,612 Y4698H probably benign Het
Ube3c T C 5: 29,606,931 Y390H possibly damaging Het
Ubqln5 A G 7: 104,128,804 I271T possibly damaging Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Xkr9 A G 1: 13,684,139 D119G probably benign Het
Zfp236 C T 18: 82,630,027 C1003Y probably damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8506:Fga UTSW 3 83033316 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGACCAGCCTGAGTAGCTAAAG -3'
(R):5'- ATCTGCCGCATTTCTGTTAATG -3'

Sequencing Primer
(F):5'- CCAGCCTGAGTAGCTAAAGACAAAG -3'
(R):5'- GAAGCTGGCTCTTAAAACTTCCGG -3'
Posted On2020-06-30