Mutagenetix > Incidental Mutation

Incidental Mutation 'R8153:Otof'

633130

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

067579-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R8153 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30524406-30619276 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 30546079 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 425 (A425S)

Ref Sequence

ENSEMBL: ENSMUSP00000073803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074171
AA Change: A425S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: A425S

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114747
AA Change: A440S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: A440S

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	A	7: 41,275,157 (GRCm39)	S287T	probably benign	Het
Abca15	T	C	7: 119,999,812 (GRCm39)	S1429P	probably damaging	Het
Arfgef2	GTGTGCAGAAACT	GT	2: 166,676,383 (GRCm39)	92	probably null	Het
C1qb	A	G	4: 136,607,877 (GRCm39)	V162A	possibly damaging	Het
Cachd1	G	T	4: 100,845,835 (GRCm39)		probably null	Het
Cfap61	T	C	2: 146,042,704 (GRCm39)	I1159T	probably benign	Het
Csf1	T	A	3: 107,656,020 (GRCm39)	D337V	probably damaging	Het
Ddhd2	T	A	8: 26,240,816 (GRCm39)	T251S	probably benign	Het
Dnah5	A	G	15: 28,384,576 (GRCm39)	T3107A	probably damaging	Het
Dnph1	T	C	17: 46,809,965 (GRCm39)	V169A	probably benign	Het
Ebf2	T	C	14: 67,627,914 (GRCm39)	V303A	probably damaging	Het
Eif4a3l2	A	T	6: 116,528,968 (GRCm39)	I282F	probably damaging	Het
Enpp3	A	G	10: 24,685,777 (GRCm39)	F206S	probably damaging	Het
Fam151b	G	T	13: 92,614,410 (GRCm39)	T26K	probably damaging	Het
Fga	T	C	3: 82,938,164 (GRCm39)	S180P	probably damaging	Het
Fpr-rs3	A	G	17: 20,844,685 (GRCm39)	L152P	probably damaging	Het
Gen1	C	A	12: 11,310,948 (GRCm39)	G95W	probably damaging	Het
Ggta1	T	A	2: 35,313,333 (GRCm39)	T3S	possibly damaging	Het
Gm4884	T	A	7: 40,692,582 (GRCm39)	C184S	probably benign	Het
Gpr137b	T	C	13: 13,533,991 (GRCm39)	Y355C		Het
Gsx2	T	C	5: 75,237,716 (GRCm39)	S223P	probably damaging	Het
Hnf4g	C	T	3: 3,699,250 (GRCm39)		probably benign	Het
Iqub	A	C	6: 24,450,789 (GRCm39)	Y603*	probably null	Het
Klhl22	A	G	16: 17,610,414 (GRCm39)	N555S	probably damaging	Het
Lama5	T	C	2: 179,829,724 (GRCm39)	D1928G	probably benign	Het
Lamb2	C	T	9: 108,357,845 (GRCm39)	R123W	probably damaging	Het
Lamc2	CATCAGCTA	CA	1: 152,999,850 (GRCm39)		probably null	Het
Lgr4	T	A	2: 109,830,645 (GRCm39)	F255I	probably damaging	Het
Lnx2	T	C	5: 146,964,906 (GRCm39)	N439S	probably benign	Het
Lztr1	G	T	16: 17,336,439 (GRCm39)		probably null	Het
Mtcl3	G	T	10: 29,024,235 (GRCm39)	E384*	probably null	Het
Nfkb2	G	T	19: 46,296,455 (GRCm39)	R241L	probably damaging	Het
Nrcam	T	C	12: 44,631,755 (GRCm39)	F1103L	probably benign	Het
Or2g1	A	G	17: 38,106,367 (GRCm39)	I11V	probably benign	Het
Or5k17	A	G	16: 58,746,149 (GRCm39)	S262P	possibly damaging	Het
Or8d2	A	G	9: 38,759,631 (GRCm39)	I74V	possibly damaging	Het
Or8g52	A	G	9: 39,630,954 (GRCm39)	M144V	possibly damaging	Het
Parg	T	A	14: 31,984,777 (GRCm39)	L774H	probably damaging	Het
Pcnx1	C	T	12: 81,965,593 (GRCm39)	R59*	probably null	Het
Pcnx4	T	A	12: 72,603,017 (GRCm39)	F426L	probably benign	Het
Pde5a	T	G	3: 122,646,225 (GRCm39)	S805R	probably benign	Het
Pde5a	T	A	3: 122,646,227 (GRCm39)	M806K	probably damaging	Het
Plekhh1	T	C	12: 79,125,812 (GRCm39)	S1283P	probably benign	Het
Ppp1r12a	A	G	10: 107,998,303 (GRCm39)	K15E	probably damaging	Het
Prkdc	A	T	16: 15,482,108 (GRCm39)	M384L	probably damaging	Het
Ptchd4	A	G	17: 42,814,787 (GRCm39)	D896G	probably benign	Het
Rsf1	GGC	GGCTACGGCCGC	7: 97,229,113 (GRCm39)		probably benign	Het
Slmap	T	C	14: 26,254,488 (GRCm39)	S65G	probably benign	Het
Snta1	C	A	2: 154,222,722 (GRCm39)	L298F	probably damaging	Het
Sphkap	T	G	1: 83,255,730 (GRCm39)	N673T	possibly damaging	Het
St8sia5	T	G	18: 77,340,807 (GRCm39)		probably null	Het
Tgm6	T	C	2: 129,986,975 (GRCm39)	V481A	probably benign	Het
Thada	T	C	17: 84,700,855 (GRCm39)	N1217S	possibly damaging	Het
Tia1	C	G	6: 86,397,314 (GRCm39)	H107D	probably damaging	Het
Ttn	A	G	2: 76,746,956 (GRCm39)	Y4698H	probably benign	Het
Ube3c	T	C	5: 29,811,929 (GRCm39)	Y390H	possibly damaging	Het
Ubqln5	A	G	7: 103,778,011 (GRCm39)	I271T	possibly damaging	Het
Vmn2r109	A	G	17: 20,784,969 (GRCm39)	V17A	probably benign	Het
Xkr9	A	G	1: 13,754,363 (GRCm39)	D119G	probably benign	Het
Zfp236	C	T	18: 82,648,152 (GRCm39)	C1003Y	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30,533,248 (GRCm39)	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30,532,967 (GRCm39)	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30,556,666 (GRCm39)	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30,543,097 (GRCm39)	critical splice donor site	probably null
IGL01019:Otof	APN	5	30,562,560 (GRCm39)	missense	probably benign	0.01
IGL01025:Otof	APN	5	30,541,597 (GRCm39)	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30,533,617 (GRCm39)	critical splice donor site	probably null
IGL01110:Otof	APN	5	30,619,069 (GRCm39)	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30,538,879 (GRCm39)	missense	probably benign	0.00
IGL01285:Otof	APN	5	30,562,527 (GRCm39)	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30,598,723 (GRCm39)	missense	probably benign	0.00
IGL01337:Otof	APN	5	30,576,856 (GRCm39)	missense	probably benign	0.17
IGL01337:Otof	APN	5	30,563,121 (GRCm39)	missense	possibly damaging	0.93
IGL01834:Otof	APN	5	30,556,564 (GRCm39)	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30,536,598 (GRCm39)	splice site	probably benign
IGL01969:Otof	APN	5	30,539,827 (GRCm39)	splice site	probably benign
IGL02075:Otof	APN	5	30,528,070 (GRCm39)	missense	probably benign	0.23
IGL02077:Otof	APN	5	30,556,579 (GRCm39)	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30,531,336 (GRCm39)	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30,528,128 (GRCm39)	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30,534,026 (GRCm39)	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30,531,426 (GRCm39)	missense	probably benign	0.08
IGL02864:Otof	APN	5	30,543,685 (GRCm39)	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30,562,520 (GRCm39)	splice site	probably null
R0285:Otof	UTSW	5	30,536,877 (GRCm39)	critical splice donor site	probably null
R0421:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30,529,225 (GRCm39)	splice site	probably benign
R0599:Otof	UTSW	5	30,528,049 (GRCm39)	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30,539,705 (GRCm39)	missense	probably benign	0.01
R0715:Otof	UTSW	5	30,552,041 (GRCm39)	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30,528,087 (GRCm39)	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30,529,256 (GRCm39)	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30,536,039 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1474:Otof	UTSW	5	30,536,876 (GRCm39)	critical splice donor site	probably null
R1524:Otof	UTSW	5	30,536,900 (GRCm39)	missense	probably benign	0.03
R1563:Otof	UTSW	5	30,528,349 (GRCm39)	missense	probably benign	0.00
R1732:Otof	UTSW	5	30,543,815 (GRCm39)	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30,536,054 (GRCm39)	missense	probably benign	0.00
R1845:Otof	UTSW	5	30,529,067 (GRCm39)	nonsense	probably null
R1925:Otof	UTSW	5	30,551,532 (GRCm39)	missense	probably benign	0.37
R1938:Otof	UTSW	5	30,533,713 (GRCm39)	missense	probably benign	0.00
R1968:Otof	UTSW	5	30,545,998 (GRCm39)	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30,578,381 (GRCm39)	missense	probably benign	0.01
R1999:Otof	UTSW	5	30,546,116 (GRCm39)	missense	probably benign	0.19
R2027:Otof	UTSW	5	30,578,358 (GRCm39)	missense	probably benign	0.08
R2138:Otof	UTSW	5	30,619,114 (GRCm39)	missense	probably benign	0.01
R2173:Otof	UTSW	5	30,543,718 (GRCm39)	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30,527,551 (GRCm39)	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30,540,184 (GRCm39)	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30,539,145 (GRCm39)	missense	probably benign	0.03
R3442:Otof	UTSW	5	30,529,033 (GRCm39)	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30,542,610 (GRCm39)	missense	probably benign
R3715:Otof	UTSW	5	30,534,215 (GRCm39)	nonsense	probably null
R3806:Otof	UTSW	5	30,543,843 (GRCm39)	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30,528,056 (GRCm39)	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30,556,635 (GRCm39)	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30,576,850 (GRCm39)	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30,539,762 (GRCm39)	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30,542,508 (GRCm39)	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30,532,344 (GRCm39)	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30,578,318 (GRCm39)	critical splice donor site	probably null
R4773:Otof	UTSW	5	30,552,026 (GRCm39)	missense	probably benign	0.05
R4839:Otof	UTSW	5	30,576,748 (GRCm39)	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30,536,005 (GRCm39)	critical splice donor site	probably null
R4961:Otof	UTSW	5	30,540,837 (GRCm39)	intron	probably benign
R4991:Otof	UTSW	5	30,551,525 (GRCm39)	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30,540,238 (GRCm39)	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30,527,483 (GRCm39)	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30,534,064 (GRCm39)	missense	probably benign	0.01
R5365:Otof	UTSW	5	30,539,144 (GRCm39)	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30,532,323 (GRCm39)	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30,571,888 (GRCm39)	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30,529,279 (GRCm39)	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30,576,877 (GRCm39)	missense	probably benign
R6701:Otof	UTSW	5	30,528,141 (GRCm39)	nonsense	probably null
R6792:Otof	UTSW	5	30,532,978 (GRCm39)	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30,545,583 (GRCm39)	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30,528,987 (GRCm39)	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30,538,882 (GRCm39)	missense	probably benign	0.32
R7060:Otof	UTSW	5	30,545,700 (GRCm39)	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30,532,964 (GRCm39)	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30,540,878 (GRCm39)	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30,545,614 (GRCm39)	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30,527,614 (GRCm39)	missense	probably benign	0.45
R7397:Otof	UTSW	5	30,533,051 (GRCm39)	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30,542,532 (GRCm39)	missense	probably benign	0.04
R7428:Otof	UTSW	5	30,547,169 (GRCm39)	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30,552,005 (GRCm39)	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30,528,364 (GRCm39)	missense	probably benign	0.00
R7714:Otof	UTSW	5	30,527,597 (GRCm39)	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30,537,954 (GRCm39)	missense	probably benign	0.10
R8032:Otof	UTSW	5	30,619,142 (GRCm39)	start codon destroyed	probably benign	0.07
R8158:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8159:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8441:Otof	UTSW	5	30,538,200 (GRCm39)	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30,545,968 (GRCm39)	nonsense	probably null
R8813:Otof	UTSW	5	30,540,242 (GRCm39)	missense	probably benign	0.02
R8835:Otof	UTSW	5	30,528,264 (GRCm39)	missense	probably benign	0.44
R8852:Otof	UTSW	5	30,529,044 (GRCm39)	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30,578,325 (GRCm39)	missense	probably benign	0.08
R9029:Otof	UTSW	5	30,527,419 (GRCm39)	critical splice donor site	probably null
R9031:Otof	UTSW	5	30,537,532 (GRCm39)	missense	probably benign
R9061:Otof	UTSW	5	30,546,001 (GRCm39)	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30,539,696 (GRCm39)	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30,536,462 (GRCm39)	missense	probably benign	0.04
R9188:Otof	UTSW	5	30,534,095 (GRCm39)	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30,542,469 (GRCm39)	missense	probably benign
R9280:Otof	UTSW	5	30,528,894 (GRCm39)	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30,532,976 (GRCm39)	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30,540,863 (GRCm39)	critical splice donor site	probably null
R9407:Otof	UTSW	5	30,538,265 (GRCm39)	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30,539,708 (GRCm39)	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30,584,895 (GRCm39)	missense	probably benign	0.22
R9748:Otof	UTSW	5	30,540,998 (GRCm39)	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30,536,576 (GRCm39)	missense	probably benign
Z1176:Otof	UTSW	5	30,528,930 (GRCm39)	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30,541,002 (GRCm39)	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30,533,641 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTGATGTTTTGCCCTGG -3'
(R):5'- ACAGATTATGCTAAGCCCCAG -3'

Sequencing Primer
(F):5'- AAGCCATATTATGTGTGCCAGTG -3'
(R):5'- CCAGGCAGCTGCTAAGATG -3'

Posted On

2020-06-30