Incidental Mutation 'R8153:St8sia5'
ID633169
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8153 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 77253111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect probably null
Transcript: ENSMUST00000075290
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079618
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,625,733 S287T probably benign Het
Abca15 T C 7: 120,400,589 S1429P probably damaging Het
Arfgef2 GTGTGCAGAAACT GT 2: 166,834,463 probably null Het
C1qb A G 4: 136,880,566 V162A possibly damaging Het
Cachd1 G T 4: 100,988,638 probably null Het
Cfap61 T C 2: 146,200,784 I1159T probably benign Het
Csf1 T A 3: 107,748,704 D337V probably damaging Het
Ddhd2 T A 8: 25,750,789 T251S probably benign Het
Dnah5 A G 15: 28,384,430 T3107A probably damaging Het
Dnph1 T C 17: 46,499,039 V169A probably benign Het
Ebf2 T C 14: 67,390,465 V303A probably damaging Het
Enpp3 A G 10: 24,809,879 F206S probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fga T C 3: 83,030,857 S180P probably damaging Het
Fpr-rs3 A G 17: 20,624,423 L152P probably damaging Het
Gen1 C A 12: 11,260,947 G95W probably damaging Het
Ggta1 T A 2: 35,423,321 T3S possibly damaging Het
Gm4884 T A 7: 41,043,158 C184S probably benign Het
Gm5580 A T 6: 116,552,007 I282F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsx2 T C 5: 75,077,055 S223P probably damaging Het
Hnf4g C T 3: 3,634,190 probably benign Het
Iqub A C 6: 24,450,790 Y603* probably null Het
Klhl22 A G 16: 17,792,550 N555S probably damaging Het
Lama5 T C 2: 180,187,931 D1928G probably benign Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Lamc2 CATCAGCTA CA 1: 153,124,104 probably null Het
Lgr4 T A 2: 110,000,300 F255I probably damaging Het
Lnx2 T C 5: 147,028,096 N439S probably benign Het
Lztr1 G T 16: 17,518,575 probably null Het
Nfkb2 G T 19: 46,308,016 R241L probably damaging Het
Nrcam T C 12: 44,584,972 F1103L probably benign Het
Olfr123 A G 17: 37,795,476 I11V probably benign Het
Olfr181 A G 16: 58,925,786 S262P possibly damaging Het
Olfr924 A G 9: 38,848,335 I74V possibly damaging Het
Olfr965 A G 9: 39,719,658 M144V possibly damaging Het
Otof C A 5: 30,388,735 A425S probably damaging Het
Parg T A 14: 32,262,820 L774H probably damaging Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pcnx4 T A 12: 72,556,243 F426L probably benign Het
Pde5a T G 3: 122,852,576 S805R probably benign Het
Pde5a T A 3: 122,852,578 M806K probably damaging Het
Plekhh1 T C 12: 79,079,038 S1283P probably benign Het
Ppp1r12a A G 10: 108,162,442 K15E probably damaging Het
Prkdc A T 16: 15,664,244 M384L probably damaging Het
Ptchd4 A G 17: 42,503,896 D896G probably benign Het
Rsf1 GGC GGCTACGGCCGC 7: 97,579,906 probably benign Het
Slmap T C 14: 26,533,333 S65G probably benign Het
Snta1 C A 2: 154,380,802 L298F probably damaging Het
Soga3 G T 10: 29,148,239 E384* probably null Het
Sphkap T G 1: 83,278,009 N673T possibly damaging Het
Tgm6 T C 2: 130,145,055 V481A probably benign Het
Thada T C 17: 84,393,427 N1217S possibly damaging Het
Tia1 C G 6: 86,420,332 H107D probably damaging Het
Ttn A G 2: 76,916,612 Y4698H probably benign Het
Ube3c T C 5: 29,606,931 Y390H possibly damaging Het
Ubqln5 A G 7: 104,128,804 I271T possibly damaging Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Xkr9 A G 1: 13,684,139 D119G probably benign Het
Zfp236 C T 18: 82,630,027 C1003Y probably damaging Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
R7784:St8sia5 UTSW 18 77254550 missense probably benign 0.36
R8037:St8sia5 UTSW 18 77248542 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACCTACAGTAAGCACATCCTTTC -3'
(R):5'- TATAGGCTCCCCATGTGTGC -3'

Sequencing Primer
(F):5'- ACAGTAAGCACATCCTTTCCTTCC -3'
(R):5'- GCTCCCCATGTGTGCAAATG -3'
Posted On2020-06-30