Incidental Mutation 'R8154:Lmod3'
ID633200
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Nameleiomodin 3 (fetal)
Synonyms5430424A14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R8154 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location97238534-97252759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97247980 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 293 (K293N)
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
Predicted Effect probably damaging
Transcript: ENSMUST00000095655
AA Change: K293N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: K293N

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G T 3: 122,924,493 G12C probably damaging Het
Adamts10 C A 17: 33,537,928 P357T probably damaging Het
Bmyc T A 2: 25,707,334 S137T probably damaging Het
Bpifa1 T A 2: 154,145,734 M168K possibly damaging Het
C530008M17Rik A T 5: 76,841,797 E62D unknown Het
Card11 T G 5: 140,900,977 K339T probably damaging Het
Ccdc149 C T 5: 52,385,104 probably null Het
Ccr9 T C 9: 123,779,831 S193P probably benign Het
Csf2rb A G 15: 78,340,442 probably null Het
Cux1 T C 5: 136,252,580 E576G probably damaging Het
Cyp4a30b A G 4: 115,458,296 N238S probably benign Het
D430042O09Rik T C 7: 125,813,630 L382P probably damaging Het
Dnaja3 C A 16: 4,699,876 T375K possibly damaging Het
Espnl C T 1: 91,325,199 H217Y possibly damaging Het
Exoc4 T C 6: 33,910,538 S754P probably benign Het
Fcgbp A G 7: 28,085,082 D189G probably benign Het
Gle1 T A 2: 29,938,607 probably null Het
Gm5346 A T 8: 43,625,387 I600N probably damaging Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gtf2i A T 5: 134,251,867 F583L probably benign Het
Heatr9 T A 11: 83,511,877 Y532F possibly damaging Het
Hic2 C T 16: 17,258,480 S391L probably benign Het
Hipk1 A G 3: 103,749,336 V905A probably damaging Het
Inpp5f T G 7: 128,664,267 W211G possibly damaging Het
Kcnma1 T A 14: 23,311,754 Y1123F possibly damaging Het
Lamb2 C T 9: 108,480,646 R123W probably damaging Het
Ldlrad4 C T 18: 68,254,222 R202* probably null Het
Luzp1 T C 4: 136,541,884 S473P possibly damaging Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map4k4 T G 1: 40,021,142 Y1030* probably null Het
Miga1 A G 3: 152,320,700 probably benign Het
Mrpl18 T C 17: 12,911,721 E167G probably damaging Het
Myh4 A G 11: 67,253,374 E1190G probably damaging Het
Ngef C T 1: 87,540,760 M92I probably benign Het
Nlrc4 T A 17: 74,445,909 Y493F probably damaging Het
Olfr601 A C 7: 103,358,556 C213G probably benign Het
Otud7a C A 7: 63,757,864 F638L probably benign Het
Padi2 T A 4: 140,924,309 probably null Het
Pcdhgb1 A G 18: 37,682,543 I696V probably damaging Het
Pikfyve T C 1: 65,265,789 F1745S probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prrc2b C T 2: 32,218,677 A1637V probably benign Het
Rab3il1 A T 19: 10,027,572 M57L possibly damaging Het
Rbl2 A G 8: 91,107,197 D885G probably damaging Het
Rbm25 A G 12: 83,644,431 M47V unknown Het
Rd3l T A 12: 111,980,204 H46L probably benign Het
Scn5a C G 9: 119,562,545 R27P possibly damaging Het
Set T A 2: 30,069,088 V99D probably benign Het
Sh3tc1 T A 5: 35,718,352 I138F probably damaging Het
Slf2 T A 19: 44,935,157 S137T possibly damaging Het
Smg8 A T 11: 87,085,237 M506K possibly damaging Het
Stpg2 G A 3: 139,309,177 V368M probably damaging Het
Trav16d-dv11 T C 14: 53,047,542 V25A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Vrk1 A G 12: 106,070,534 K360E probably benign Het
Xirp2 T A 2: 67,511,673 H1419Q possibly damaging Het
Yes1 T C 5: 32,645,022 F94L probably damaging Het
Zc2hc1c T C 12: 85,290,172 L201P probably benign Het
Zfp638 C T 6: 83,977,409 R1499W probably damaging Het
Znfx1 A T 2: 167,055,237 L589Q probably damaging Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97252297 missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97247861 missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97252552 missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97247672 missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97238835 utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97247195 missense possibly damaging 0.92
Runted UTSW 6 97247273 missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97247345 missense probably damaging 1.00
R0627:Lmod3 UTSW 6 97248071 missense probably damaging 0.96
R2208:Lmod3 UTSW 6 97247877 missense probably benign 0.06
R4038:Lmod3 UTSW 6 97248314 missense probably benign 0.06
R4913:Lmod3 UTSW 6 97247164 splice site probably null
R5867:Lmod3 UTSW 6 97248002 missense probably damaging 1.00
R5905:Lmod3 UTSW 6 97247614 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97252553 missense probably damaging 1.00
R6210:Lmod3 UTSW 6 97247301 missense probably damaging 1.00
R6527:Lmod3 UTSW 6 97247378 missense probably benign 0.00
R7225:Lmod3 UTSW 6 97247384 missense probably benign 0.34
R7531:Lmod3 UTSW 6 97248442 missense probably benign 0.01
R7908:Lmod3 UTSW 6 97248473 missense probably benign 0.05
R8022:Lmod3 UTSW 6 97248299 missense probably benign
R8325:Lmod3 UTSW 6 97247418 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTCATTGAACTGGAGGCACCTC -3'
(R):5'- GGCTACTAAAACAGCGCACG -3'

Sequencing Primer
(F):5'- TTGAACTGGAGGCACCTCATGATG -3'
(R):5'- GACCCTAAGAAGTTAGCTCTAGATAC -3'
Posted On2020-06-30